mead
Uploaded by
36 SLIDES
514 VIEWS
360LIKES

Chapter 16

DESCRIPTION

Chapter 16. Molecular Basis of Inheritance. DNA genetic material. Chromosomes composed of DNA + protein. DNA base composition. Nucleotide base Guanine Cytosine Thymine Adenine. Guanine, C 5 H 5 N 5 O. DNA is a polymer of nucleotides. Chargaff’s rules (1950).

1 / 36

Download Presentation

Chapter 16

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 16 Molecular Basis of Inheritance

  2. DNA genetic material • Chromosomes composed of DNA + protein

  3. DNA base composition Nucleotide base Guanine Cytosine Thymine Adenine Guanine, C5H5N5O

  4. DNA is a polymer of nucleotides

  5. Chargaff’s rules (1950) [T] = [A] [G] = [C] A certain chromosome is 19% A. What is the % of C?

  6. DNA structural model Watson, Crick, Franklin 1953 X-ray crystallography DNA is helical Spacing of bases Width of helix suggested 2 strands

  7. DNA double helix Sugar-phosphate “backbone” Anti parallel strands

  8. Bases face inward • Hydrogen bonds connect bases

  9. A - T (2 bonds) G - C ( 3 bonds)

  10. Original DNA copied to new DNA helix Original DNA broken up and combined in new DNA 1 strand original DNA maintained in new DNA

  11. Meselson and Stahl 1950s • Label DNA (E. coli) with 15N in growth media 2. Transfer E. coli to 14N media for 1 generation (20 min)

  12. Results: The density of the DNA is intermediate Cells grown longer 14N, make lighter DNA

  13. What would the DNA density be after 20 more minutes of cell group? 14N DNA 1.710 gm/cm3 15N DNA1.724 gm/cm3

  14. DNA replication is semi-conservative

  15. DNA replication: mechanism (E. coli) E. coli genome = 4 X 10 6 bp DNA 1 circular chromosome 1 origin of replication (ori)

  16. Ori nucleotides • Replication proteins attach to ori • Forms a replication bubble • Two strands of DNA open

  17. Replication fork in both directions

  18. Proteins in DNA replication Table 16.1 • DNA polymerase (enzyme) Adds nucleotides 5’  3’ direction only

  19. 2. Helicase (enzyme) – unwinds double helix 3. Single stranded binding protein (SSB) binds to DNA strands to stabilize them

  20. 4. Topoisomerase (enzyme) – breaks, rejoins DNA to relieve physical stress 5. Primase – synthesizes a primer

  21. Leading strand is Lagging strand is Each strand is a template for new DNA

  22. DNA replication leading strand: steps • Primase (enzyme) • synthesizes primer complementary to leading strand • primer is ~10 bases

  23. 2. DNA polymerase (pol III) synthesizes new strand 5’  3’ G, A, T, C nucleotides complementary to template strand 500 nuc/sec Continuous elongation until end of chromosome

  24. DNA Synthesis steps: lagging strand 1. Primase makes RNA primer 2. DNA adds nucleotides to primer in 5’  3’ direction only

  25. 3. DNA pol III detaches Okazaki fragment • ~ 1, 000 nucleotides long

  26. 4. Another primer added, another Okazaki fragment formed Many primers needed

  27. 5. Gaps between primers filled in 6. Ligase enzyme bonds fragments

  28. DNA replication Fig. 16.17

  29. Telomeres, the protective ends

  30. Linear DNA has telomeres • No genes • Repetitive DNA TTAGGG up to 1000 times 5'...TTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGG..3‘ 3'...AATCCC AATCCCAATCCCAATCCCAATCCC AATCCC..5' Human chromosomes capped by telomeres

  31. Chromosomes shorten with each cell division

  32. When telomeres are too short  cell senescence (irreversible) ~ 125 cell divisions (humans)……life span? Telomeres shorten ~100 bp each time cell divides Mouse fibroblasts in culture

  33. Cells that do not divide often • Example: heart muscle Telomeres do not shorten with age

  34. Lagging strand problem • Animation garland

  35. Embryonic cells, some wbc, stem cells, cancer cells express telomerase White blood cell cervical cancer cell embryo

More Related