DNA is genetic material.
160 likes | 304 Views
DNA is genetic material. TAATACGACTCACTATAGGGAGA. Parts are basic biological functions that can be encoded as genetic material. R0083. TAATACGACTCACTATAGGGAGA. R0083 Type: Promoter Family: Protein:DNA Activity: 2 PoPS Requires: C0083 Cell Type: Any Temp: < Tm
DNA is genetic material.
E N D
Presentation Transcript
DNA is genetic material. TAATACGACTCACTATAGGGAGA
Parts are basic biological functions that can be encoded as genetic material. R0083 TAATACGACTCACTATAGGGAGA R0083 Type: Promoter Family: Protein:DNA Activity: 2 PoPS Requires: C0083 Cell Type: Any Temp: < Tm Issues: None License: Public
TetR CI Otet RBS Lambda cI Term.
C0040 C0051 R0040 B0034 C0051 B0015
C0040 C0051 R0040 B0034 C0051 B0015
Devices are combinations of one or more parts that encode human-defined functions. C0040 to C0051 INVERTER C0040 C0051
C0040 to C0051 INVERTER C0051 to C0010 INVERTER C0010 to C0040 INVERTER Systems are combinations of one or more devices that encode human-defined functions.
C0040 C0051 R0040 B0034 C0051 B0015
PoPS, Not Proteins! C0051 B0034 C0051 B0015 R0051 Endy D From Details to a Device http://openwetware.org/wiki/BE.180:Devices
Endy D, Deese I, Wadey C Adventures in Synthetic Biology Nature 24 November 2005 http://openwetware.org/wiki/Adventures
Systems Devices Parts DNA