slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
DNA is genetic material. PowerPoint Presentation
Download Presentation
DNA is genetic material.

Loading in 2 Seconds...

play fullscreen
1 / 16

DNA is genetic material. - PowerPoint PPT Presentation


  • 105 Views
  • Uploaded on

DNA is genetic material. TAATACGACTCACTATAGGGAGA. Parts are basic biological functions that can be encoded as genetic material. R0083. TAATACGACTCACTATAGGGAGA. R0083 Type: Promoter Family: Protein:DNA Activity: 2 PoPS Requires: C0083 Cell Type: Any Temp: < Tm

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'DNA is genetic material.' - marva


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

DNA is genetic material.

TAATACGACTCACTATAGGGAGA

slide2

Parts are basic biological functions

that can be encoded as genetic material.

R0083

TAATACGACTCACTATAGGGAGA

R0083

Type: Promoter

Family: Protein:DNA

Activity: 2 PoPS

Requires: C0083

Cell Type: Any

Temp: < Tm

Issues: None

License: Public

slide3

TetR

CI

Otet

RBS

Lambda cI

Term.

slide4

C0040

C0051

R0040

B0034

C0051

B0015

slide5

C0040

C0051

R0040

B0034

C0051

B0015

slide6

Devices are combinations of one or more parts that encode human-defined functions.

C0040 to C0051

INVERTER

C0040

C0051

slide7

C0040 to C0051

INVERTER

C0051 to C0010

INVERTER

C0010 to C0040

INVERTER

Systems are combinations of one or more devices that encode human-defined functions.

slide8

C0040

C0051

R0040

B0034

C0051

B0015

slide9

PoPS, Not Proteins!

C0051

B0034

C0051

B0015

R0051

Endy D

From Details to a Device

http://openwetware.org/wiki/BE.180:Devices

slide10

Endy D, Deese I, Wadey C

Adventures in Synthetic Biology

Nature 24 November 2005

http://openwetware.org/wiki/Adventures

slide11

Systems

Devices

Parts

DNA