Dr. Wellington Silva

2. Dr. Wellington Silva

4. Diversas representa��es da mol�cula de Hb. As prote�nas s�o pequenas demais para poderem ser vistas. Mesmo quando observadas ao microsc�pio eletr�nico, em geral suas estruturas n�o podem ser vistas com precis�o. A) As espirais s�o um determinado tipo de estrutura prot�ica (a-h�lice), as quatro subunidades est�o representadas em cores diferentes e o grupo Heme em seus respectivos centros est� representado de forma detalhada. B) A a-h�lice � apresentada de forma simplificada (como um tubo). Al�m disso, est�o registrados os amino�cidos da cadeia. C) Nesta representa��o resumida pode-se ver que a prote�na � constitu�da de quatro subunidades, sendo que as subunidades de cada para s�o id�nticas entre si. D) Neste modelo leva-se em considera��o a dilata��o espacial dos �tomos. Assim, tem-se uma id�ia da forma real. E) As subunidades n�o s�o diferenciadas. A mol�cula poderia ser vista assim, se ela fosse maior. Os grupos Heme s�o de outra cor para salientar que eles n�o fazem parte da seq��ncia prot�ica. F) Neste modelo cada �tomo est� registrado como um ponto. Diversas representa��es da mol�cula de Hb. As prote�nas s�o pequenas demais para poderem ser vistas. Mesmo quando observadas ao microsc�pio eletr�nico, em geral suas estruturas n�o podem ser vistas com precis�o. A) As espirais s�o um determinado tipo de estrutura prot�ica (a-h�lice), as quatro subunidades est�o representadas em cores diferentes e o grupo Heme em seus respectivos centros est� representado de forma detalhada. B) A a-h�lice � apresentada de forma simplificada (como um tubo). Al�m disso, est�o registrados os amino�cidos da cadeia. C) Nesta representa��o resumida pode-se ver que a prote�na � constitu�da de quatro subunidades, sendo que as subunidades de cada para s�o id�nticas entre si. D) Neste modelo leva-se em considera��o a dilata��o espacial dos �tomos. Assim, tem-se uma id�ia da forma real. E) As subunidades n�o s�o diferenciadas. A mol�cula poderia ser vista assim, se ela fosse maior. Os grupos Heme s�o de outra cor para salientar que eles n�o fazem parte da seq��ncia prot�ica. F) Neste modelo cada �tomo est� registrado como um ponto.

5. No centro ativo da mol�cula de Hb. Encontra-se o grupo Heme, com o �tomo de ferro central. Ele � mantido em sua posi��o por um determinado amino�cido (Histidina � F8). O �tomo de ferro pode ligar-se � uma mol�cula de Oxig�nio. No centro ativo da mol�cula de Hb. Encontra-se o grupo Heme, com o �tomo de ferro central. Ele � mantido em sua posi��o por um determinado amino�cido (Histidina � F8). O �tomo de ferro pode ligar-se � uma mol�cula de Oxig�nio.

6. A heme (American English) or haem (British English) is a prosthetic group that consists of an iron atom contained in the center of a large heterocyclic organic ring called a porphyrin. Not all porphyrins contain iron, but a substantial fraction of porphyrin-containing metalloproteins have heme as their prosthetic subunit; these are known as hemoproteins. Hemoproteins have diverse biological functions including the transportation of diatomic gases, chemical catalysis, diatomic gas detection, and electron transfer. The heme iron serves as a source or sink of electrons during electron transfer or redox chemistry. In peroxidase reactions, the porphyrin molecule also serves as an electron source. In the transportation or detection of diatomic gases, the gas binds to the heme iron. During the detection of diatomic gases, the binding of the gas ligand to the heme iron induces conformational changes in the surrounding protein. It has been speculated that the original evolutionary function of hemoproteins was electron transfer in primitive sulfur-based photosynthesis pathways in ancestral cyanobacteria before the appearance of molecular oxygen. [4] Hemoproteins achieve their remarkable functional diversity by modifying the environment of the heme macrocycle within the protein matrix. For example, the ability of hemoglobin to effectively deliver oxygen to tissues is due to specific amino acid residues located near the heme molecule. Hemoglobin binds oxygen in the pulmonary vasculature, where the pH is high and the pCO2 is low, and releases it in the tissues, where the situations are reversed. This phenomenon is known as the Bohr effect. The molecular mechanism behind this effect is the steric organization of the globin chain; a histidine residue, located adjacent to the heme group, becomes positively charged under acid circumstances, sterically releasing oxygen from the heme group.A heme (American English) or haem (British English) is a prosthetic group that consists of an iron atom contained in the center of a large heterocyclic organic ring called a porphyrin. Not all porphyrins contain iron, but a substantial fraction of porphyrin-containing metalloproteins have heme as their prosthetic subunit; these are known as hemoproteins. Hemoproteins have diverse biological functions including the transportation of diatomic gases, chemical catalysis, diatomic gas detection, and electron transfer. The heme iron serves as a source or sink of electrons during electron transfer or redox chemistry. In peroxidase reactions, the porphyrin molecule also serves as an electron source. In the transportation or detection of diatomic gases, the gas binds to the heme iron. During the detection of diatomic gases, the binding of the gas ligand to the heme iron induces conformational changes in the surrounding protein. It has been speculated that the original evolutionary function of hemoproteins was electron transfer in primitive sulfur-based photosynthesis pathways in ancestral cyanobacteria before the appearance of molecular oxygen. [4] Hemoproteins achieve their remarkable functional diversity by modifying the environment of the heme macrocycle within the protein matrix. For example, the ability of hemoglobin to effectively deliver oxygen to tissues is due to specific amino acid residues located near the heme molecule. Hemoglobin binds oxygen in the pulmonary vasculature, where the pH is high and the pCO2 is low, and releases it in the tissues, where the situations are reversed. This phenomenon is known as the Bohr effect. The molecular mechanism behind this effect is the steric organization of the globin chain; a histidine residue, located adjacent to the heme group, becomes positively charged under acid circumstances, sterically releasing oxygen from the heme group.

7. The enzymatic process that produces heme is properly called porphyrin synthesis, as all the intermediates are tetrapyrroles that are chemically classified are porphyrins. The process is highly conserved across biology. In humans, this pathway serves almost exclusively to form heme. In other species, it also produces similar substances such as cobalamin (vitamin B12). The pathway is initiated by the synthesis of D-Aminolevulinic acid (dALA or dALA) from the amino acid glycine and succinyl-CoA from the citric acid cycle (Krebs cycle). The rate-limiting enzyme responsible for this reaction, ALA synthase, is strictly regulated by intracellular iron levels and heme concentration. A low-iron level, e.g., in iron deficiency, leads to decreased porphyrin synthesis, which prevents accumulation of the toxic intermediates. This mechanism is of therapeutic importance: infusion of heme arginate of hematin can abort attacks of porphyria in patients with an inborn error of metabolism of this process, by reducing transcription of ALA synthase. The organs mainly involved in heme synthesis are the liver and the bone marrow, although every cell requires heme to function properly. Heme is seen as an intermediate molecule in catabolism of haemoglobin in the process of bilirubin metabolism. The enzymatic process that produces heme is properly called porphyrin synthesis, as all the intermediates are tetrapyrroles that are chemically classified are porphyrins. The process is highly conserved across biology. In humans, this pathway serves almost exclusively to form heme. In other species, it also produces similar substances such as cobalamin (vitamin B12). The pathway is initiated by the synthesis of D-Aminolevulinic acid (dALA or dALA) from the amino acid glycine and succinyl-CoA from the citric acid cycle (Krebs cycle). The rate-limiting enzyme responsible for this reaction, ALA synthase, is strictly regulated by intracellular iron levels and heme concentration. A low-iron level, e.g., in iron deficiency, leads to decreased porphyrin synthesis, which prevents accumulation of the toxic intermediates. This mechanism is of therapeutic importance: infusion of heme arginate of hematin can abort attacks of porphyria in patients with an inborn error of metabolism of this process, by reducing transcription of ALA synthase. The organs mainly involved in heme synthesis are the liver and the bone marrow, although every cell requires heme to function properly. Heme is seen as an intermediate molecule in catabolism of haemoglobin in the process of bilirubin metabolism.

8. As illustrated above, when oxygen binds to the iron center, it causes contraction of the iron atom, and causes it to move back into the center of the porphyrin ring plane (see moving diagram). At the same time, the porphyrin ring plane itself is pushed away from the oxygen and toward the imidizole side chain of the histidine residue interacting at the other pole of the iron. The interaction here forces the ring plane sideways toward the outside of the tetramer, and also induces a strain on the protein helix containing the histidine as it moves nearer to the iron. This causes a tug on the peptide strand which tends to open up heme units in the remainder of the molecule, so that there is more room for oxygen molecules to bind at their heme sites. In the tetrameric form of normal adult hemoglobin, the binding of oxygen is thus a [[cooperative binding|cooperative]] process. The binding affinity of hemoglobin for oxygen is increased by the oxygen saturation of the molecule, with the first oxygens bound influencing the shape of the binding sites for the next oxygens, in a way favorable for binding. This positive cooperative binding is achieved through [[steric effects|steric]] conformational changes of the hemoglobin protein complex as discussed above, i.e. when one subunit protein in hemoglobin becomes oxygenated, this induces a conformational or structural change in the whole complex, causing the other subunits to gain an increased affinity for oxygen. As a consequence, the oxygen binding curve of hemoglobin is [[Sigmoid function|sigmoidal]], or ''S''-shaped, as opposed to the normal [[Hyperbolic function|hyperbolic]] curve associated with noncooperative binding. Hemoglobin's oxygen-binding capacity is decreased in the presence of [[carbon monoxide]] because both gases compete for the same binding sites on hemoglobin, carbon monoxide binding preferentially in place of oxygen. Carbon ''di''oxide occupies a different binding site on the hemoglobin. Carbon dioxide is more readily dissolved in deoxygenated blood, facilitating its removal from the body after the oxygen has been released to tissues undergoing metabolism. This increased affinity for carbon dioxide by the venous blood is known as the [[Haldane effect]]. Through the enzyme [[carbonic anhydrase]], carbon dioxide reacts with water to give [[carbonic acid]], which decomposes into [[bicarbonate]] and [[proton]]s: CO2 + H2O ? H2CO3 ? HCO3- + H+ As illustrated above, when oxygen binds to the iron center, it causes contraction of the iron atom, and causes it to move back into the center of the porphyrin ring plane (see moving diagram). At the same time, the porphyrin ring plane itself is pushed away from the oxygen and toward the imidizole side chain of the histidine residue interacting at the other pole of the iron. The interaction here forces the ring plane sideways toward the outside of the tetramer, and also induces a strain on the protein helix containing the histidine as it moves nearer to the iron. This causes a tug on the peptide strand which tends to open up heme units in the remainder of the molecule, so that there is more room for oxygen molecules to bind at their heme sites. In the tetrameric form of normal adult hemoglobin, the binding of oxygen is thus a [[cooperative binding|cooperative]] process. The binding affinity of hemoglobin for oxygen is increased by the oxygen saturation of the molecule, with the first oxygens bound influencing the shape of the binding sites for the next oxygens, in a way favorable for binding. This positive cooperative binding is achieved through [[steric effects|steric]] conformational changes of the hemoglobin protein complex as discussed above, i.e. when one subunit protein in hemoglobin becomes oxygenated, this induces a conformational or structural change in the whole complex, causing the other subunits to gain an increased affinity for oxygen. As a consequence, the oxygen binding curve of hemoglobin is [[Sigmoid function|sigmoidal]], or ''S''-shaped, as opposed to the normal [[Hyperbolic function|hyperbolic]] curve associated with noncooperative binding. Hemoglobin's oxygen-binding capacity is decreased in the presence of [[carbon monoxide]] because both gases compete for the same binding sites on hemoglobin, carbon monoxide binding preferentially in place of oxygen. Carbon ''di''oxide occupies a different binding site on the hemoglobin. Carbon dioxide is more readily dissolved in deoxygenated blood, facilitating its removal from the body after the oxygen has been released to tissues undergoing metabolism. This increased affinity for carbon dioxide by the venous blood is known as the [[Haldane effect]]. Through the enzyme [[carbonic anhydrase]], carbon dioxide reacts with water to give [[carbonic acid]], which decomposes into [[bicarbonate]] and [[proton]]s: CO2 + H2O ? H2CO3 ? HCO3- + H+

14. atggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctgctggtggtctacccttggacccagaggttctttgagtcctttggggatctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcatggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggacaacctcaagggcacctttgccacactgagtgagctgcactgtgacaagctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtctgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcaggctgcctatcagaaagtggtggctggtgtggctaatgccctggcccacaagtatcactaagctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaa atggtgcatctgactcctgtggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctgctggtggtctacccttggacccagaggttctttgagtcctttggggatctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcatggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggacaacctcaagggcacctttgccacactgagtgagctgcactgtgacaagctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtctgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcaggctgcctatcagaaagtggtggctggtgtggctaatgccctggcccacaagtatcactaagctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaa

18. A hemoglobina tem sido considerada como a segunda subst�ncia mais importante do mundo; a primeira � a clorofila. � a prote�na mais estudada e conhecida sob o ponto de vista fisiol�gico, gen�tico e bioqu�mico. Estudos sobre a evolu��o das esp�cies indicam que a mol�cula precursora da hemoglobina data de aproximadamente 800 milh�es de anos, quando surgiram as plantas leguminosas; o precursor da hemoglobina nessas plantas foi denominado por leghemoglobina e deveria ter quatro genes para a sua s�ntese (etapa 1 da figura 3.1). Por volta de 700 milh�es de anos surgiram os peixes primitivos com seus eritr�citos nucleados e admite-se que houve a redu��o para tr�s genes codificadores de hemoglobina em um mesmo cromossomo (etapa 2 da figura 3.1). A evolu��o que ocorreu h� 600 milh�es de anos entre os peixes fez com que houvesse a duplica��o de cromossomos (etapa 3 da figura 3.1). Acredita-se que essa duplica��o se manteve por muito tempo, pois h� 500 milh�es de anos duas c�pias se diferenciaram por muta��es adaptativas para agrupar tr�s genes para globinas alfa num dos cromossomos e tr�s genes para globinas beta no outro cromossomo (etapa 4 da figura 3.1). Outros milh�es de anos seguintes fizeram com que o processo evolutivo duplicasse os cromossomos que agrupavam os genes para globinas alfa e para globinas beta (etapa 5 da figura 3.1). � provavelmente nessa fase (100 milh�es de anos) que surgem as primeiras esp�cies do g�nero de mam�feros. Essas esp�cies t�m evolu��o embrion�ria e fetal bem definidas, com necessidades fisiol�gicas pr�prias e desenvolvimento intra-uterino. Assim, por volta de 100 milh�es de anos os genes codificadores de globinas alfa e beta se diferenciaram individualmente para se processarem durante as fases de desenvolvimento de um ser mais complexo (etapa 6 da figura 3.1). Por fim, � muito prov�vel que h� 70 milh�es de anos quando surgiram os primeiros primatas, identificados pelo Ancestral Homin�deo Comum, os genes para a s�ntese de globina alfa e beta j� estavam bem definidos (etapa 7 da figura 3.1). A hemoglobina tem sido considerada como a segunda subst�ncia mais importante do mundo; a primeira � a clorofila. � a prote�na mais estudada e conhecida sob o ponto de vista fisiol�gico, gen�tico e bioqu�mico. Estudos sobre a evolu��o das esp�cies indicam que a mol�cula precursora da hemoglobina data de aproximadamente 800 milh�es de anos, quando surgiram as plantas leguminosas; o precursor da hemoglobina nessas plantas foi denominado por leghemoglobina e deveria ter quatro genes para a sua s�ntese (etapa 1 da figura 3.1). Por volta de 700 milh�es de anos surgiram os peixes primitivos com seus eritr�citos nucleados e admite-se que houve a redu��o para tr�s genes codificadores de hemoglobina em um mesmo cromossomo (etapa 2 da figura 3.1). A evolu��o que ocorreu h� 600 milh�es de anos entre os peixes fez com que houvesse a duplica��o de cromossomos (etapa 3 da figura 3.1). Acredita-se que essa duplica��o se manteve por muito tempo, pois h� 500 milh�es de anos duas c�pias se diferenciaram por muta��es adaptativas para agrupar tr�s genes para globinas alfa num dos cromossomos e tr�s genes para globinas beta no outro cromossomo (etapa 4 da figura 3.1). Outros milh�es de anos seguintes fizeram com que o processo evolutivo duplicasse os cromossomos que agrupavam os genes para globinas alfa e para globinas beta (etapa 5 da figura 3.1). � provavelmente nessa fase (100 milh�es de anos) que surgem as primeiras esp�cies do g�nero de mam�feros. Essas esp�cies t�m evolu��o embrion�ria e fetal bem definidas, com necessidades fisiol�gicas pr�prias e desenvolvimento intra-uterino. Assim, por volta de 100 milh�es de anos os genes codificadores de globinas alfa e beta se diferenciaram individualmente para se processarem durante as fases de desenvolvimento de um ser mais complexo (etapa 6 da figura 3.1). Por fim, � muito prov�vel que h� 70 milh�es de anos quando surgiram os primeiros primatas, identificados pelo Ancestral Homin�deo Comum, os genes para a s�ntese de globina alfa e beta j� estavam bem definidos (etapa 7 da figura 3.1).

23. Figure 3. In normal gene function (left panel), DNA is transcribed into RNA, which is then "processed" by the removal of introns (the non-coding sequences between the gray boxes) and addition of a poly(A) tail. The mature processed RNA is then translated into a chain of amino acids to form a protein. The right panels illustrate the two pathways generating the classical duplicated pseudogene (top) and processed pseudogene (bottom). In the top pathway, DNA duplication generates two copies of the entire gene (upper right box), but mutations in one copy (represented by the "x"s) render it a pseudogene. In the other pathway a processed RNA transcript of a gene can become reverse transcribed into a cDNA copy (lower right box) that inserts back into cell's DNA at a random position in the genome, usually--as shown here--in the spacer DNA between genes (white boxes in the Figure). Figure 3. In normal gene function (left panel), DNA is transcribed into RNA, which is then "processed" by the removal of introns (the non-coding sequences between the gray boxes) and addition of a poly(A) tail. The mature processed RNA is then translated into a chain of amino acids to form a protein. The right panels illustrate the two pathways generating the classical duplicated pseudogene (top) and processed pseudogene (bottom). In the top pathway, DNA duplication generates two copies of the entire gene (upper right box), but mutations in one copy (represented by the "x"s) render it a pseudogene. In the other pathway a processed RNA transcript of a gene can become reverse transcribed into a cDNA copy (lower right box) that inserts back into cell's DNA at a random position in the genome, usually--as shown here--in the spacer DNA between genes (white boxes in the Figure).

24. Figure 1: Origins of pseudogenes: A. Retrotransposed pseudogenes: starting from the original gene (the coding sequences are in black, the non-coding introns in gray, and the promoter element is indicated by the large arrow upstream of the gene), transcription generates a primary mRNA (black and gray broken line), from which the introns are excised by RNA splicing. This mature mRNA, which contains only exons and a poly-adenosine tail, is transcribed back into DNA by enzymes called reverse transcriptases, and the DNA is reinserted back into the genome. Hence, the pseudogene product will lack intron and promoter sequences, and will bear characteristic repeat sequences at the insertion site, due to the integration mechanism. B. Duplicated pseudogenes: DNA duplication generates a more-or-less faithful copy of the original gene, including introns and, in many cases, promoter and other transcriptional regulatory elements. In most cases, this duplicated gene will undergo crippling, inactivating mutations and turn into a pseudogene (in rarer cases, the duplicated copy will acquire new functions and become a new gene).Figure 1: Origins of pseudogenes: A. Retrotransposed pseudogenes: starting from the original gene (the coding sequences are in black, the non-coding introns in gray, and the promoter element is indicated by the large arrow upstream of the gene), transcription generates a primary mRNA (black and gray broken line), from which the introns are excised by RNA splicing. This mature mRNA, which contains only exons and a poly-adenosine tail, is transcribed back into DNA by enzymes called reverse transcriptases, and the DNA is reinserted back into the genome. Hence, the pseudogene product will lack intron and promoter sequences, and will bear characteristic repeat sequences at the insertion site, due to the integration mechanism. B. Duplicated pseudogenes: DNA duplication generates a more-or-less faithful copy of the original gene, including introns and, in many cases, promoter and other transcriptional regulatory elements. In most cases, this duplicated gene will undergo crippling, inactivating mutations and turn into a pseudogene (in rarer cases, the duplicated copy will acquire new functions and become a new gene).