slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Additional file 3 PowerPoint Presentation
Download Presentation
Additional file 3

Loading in 2 Seconds...

  share
play fullscreen
1 / 1
Download Presentation

Additional file 3 - PowerPoint PPT Presentation

mallory-flores
109 Views
Download Presentation

Additional file 3

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Additional file 3 >HWI-EAS344:7:70:153:1969#0/1 Length = 75  Score = 137 bits (69), Expect = 4e-29 Identities = 69/69 (100%) Strand = Plus / Plus Query: 4863 atattatgttatcgcatgtatttcggaaaaataacatgttacaaaggacatttacgtaat 4922 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 7 atattatgttatcgcatgtatttcggaaaaataacatgttacaaaggacatttacgtaat 66 >HWI-EAS344:7:17:1346:939#0/1 Length = 75  Score = 137 bits (69), Expect = 4e-29 Identities = 69/69 (100%) Strand = Plus / Plus Query: 4863 atattatgttatcgcatgtatttcggaaaaataacatgttacaaaggacatttacgtaat 4922 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 7 atattatgttatcgcatgtatttcggaaaaataacatgttacaaaggacatttacgtaat 66