slide1 l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Genetic Recombination PowerPoint Presentation
Download Presentation
Genetic Recombination

Loading in 2 Seconds...

play fullscreen
1 / 27

Genetic Recombination - PowerPoint PPT Presentation


  • 498 Views
  • Uploaded on

Purposes Promotes genetic diversity within a species - within a chromosome causes inversions, deletions, duplications - horizontal exchange introduces new sequences (information) . In the lab: . introduce foreign DNA or mutations into bacteria .

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Genetic Recombination' - lucio


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Purposes

  • Promotes genetic diversity within a species
  • - within a chromosome causes inversions, deletions, duplications
  • - horizontal exchange introduces new sequences (information)

In the lab:

introduce foreign DNA or mutations into bacteria

map the distance between mutations

Genetic Recombination

Definition: The breakage and joining of DNA into new combinations

  • Plays a major role in repair of damaged DNA and mutagenesis
  • Critical for several mechanisms of phase and antigenic variation
slide2

Types:

  • Homologous recombination (or general recombination)
    • basic steps
    • current models
    • proteins that play a role
    • practical applications
  • Nonhomologous recombination (site-specific)
    • Basic steps
    • general categories of proteins used
    • examples – phage integration, flagellin phase variation
  • Illegitimate recombination (transposition)
slide3

CACATGATACGTCCGATCACATTTGTTGTTCATAT

GTGTACTATGCAGGCTAGTGTAAACAACAAGTATA

GTGTACTATGCAGGCTAGTGTAAACAACAAGTATA

CACATGATACGTCCGATCACATTTGTTGTTCATAT

  • Results in the creation of a synapse [synapse is point where DNA strands are held
  • together by complementary base-pairing (H bonds)]

CACATGATACGTCCGATCACATTTGTTGTTCATAT

GTGTACTATGCAGGCTAGTGTAAA

Synapse

C

GTATA

A

A

A

A

C

GTATA

GTGTACTATGCAGGCTAGTGTAAA

CACATGATACGTCCGATCACATTTGTTGTTCATAT

Homologous Recombination

  • Step One
  • Formation of complementary base pairing between two ds DNA molecules

- Sequences must be the same or very similar

- 23 base pair minimum

slide4

CACATGATACGTCCGATCACATTTGTTGTTCATAT

GTGTACTATGCAGGCTAGTGTAAA

C

GTATA

CACATGATACGTCCGATCACATTTGTTGTTCATAT

GTGTA

A

A

A

A

GGCTAGTGTAAACAACAAGTATA

C

G

A

C

T

GTATA

GTGTACTATGCAGGCTAGTGTAAA

A

C

CACATGATACGTCCGATCACATTTGTTGTTCATAT

T

G

G

T

Branch migration

A

C

T

A

C

GGCTAGTGTAAACAACAAGTATA

GTGTA

CACATGATACGTCCGATCACATTTGTTGTTCATAT

Step two

Branch migration to extend the region of base-pairing (the heteroduplex)

  • ATP-hydrolyzing proteins (Ruv proteins) break and re-form H bonds
  • allow migration to go faster
slide5

CACATGATACGTCCGATCACATTTGTTGTTCATAT

GTGTACTATGCAGGCTAGTGTAAA

C

GTATA

CACATGAT ACGT CCGATCACATTTGTTGTTCATAT

GTGTA

A

A

A

A

GGCTGGTGTAAACAACAAGTATA

C

G

A

C

T

GTATA

GTGTACTATGCAGGCTGGTGTAAA

A

C

CACATGATACGTCCGACCACATTTGTTGTTCATAT

T

G

G

T

Branch migration

A

C

T

A

C

GGCTAGTGTAAACAACAAGTATA

GTGTA

CACATGAT AC GT CCGACCACATTTGTTGTTCATAT

Branch extension can increase the chance of gene conversion via increasing the

chances of including mismatches in the heteroduplex region

slide6

Step three

Resolution of the heteroduplex

- isomerization of the duplex due to strands uncrossing and re-crossing

- results in different outcomes upon resolution

- 50% chance of each isomer being resolved

slide7

Models of Homologous Recombination (I)

Holliday double-strand invasion

Fig. 10.1 of textbook

  • Initiated by two single-stranded breaks made simultaneously and exactly
  • in the same place in the DNA molecules to be recombined
  • Free ends of the two broken strands cross over each other, pairing with its
  • complementary sequence in the other DNA molecule to form heteroduplex.
  • See http://engels.genetics.wisc.edu/Holliday/holliday3D.html for strand resolution
slide8

Models of Homologous Recombination (II)

Single-strand Invasion

  • Single strand break in one molecule
  • Free ss end invades other DNA molecule
  • Gap on cut DNA is filled in by
  • DNA polymerase
  • Displaced strand on other DNA molecule
  • is degraded
  • Two ends are joined
  • Initially, heteroduplex is only on
  • one strand; branch migration causes
  • another heteroduplex on other molecule

Fig. 10.3 of textbook

slide9

Models of Homologous Recombination (III)

Double strand break-repair

  • A double stranded break occurs in one
  • molecule; and exonuclease digests the
  • 5’ ends of each break, leaving a gap
  • One of the 3’ tails invades unbroken
  • molecule; pairs with complementary
  • sequence
  • DNA polymerase extends the tail until
  • it can be joined with 5’ end
  • Displaced strand used as template to
  • replace gap on other molecule
  • Two Holliday junctions form (may
  • produce recombinant flanking DNA
  • depending how they are resolved)

Fig. 10.4 of textbook

slide10

+

or

Donor

DNA

Mutant bank

(i.e. of E. coli)

Screen for inability

to acquire a

selectable marker

Proteins involved in DNA recombination (the E. coli paradigm)

Mutation Phenotype

RecA

RecBC

RecD

RecF

RecJ

RecO

RecR

RecQ

RecN

RecG

RuvA

RuvB

RuvC

PriA

PriB

PriC

DnaT

Recombination deficient

Reduced recombination

Rec+  independent

Reduced plasmid recombination

  • Reduced recombination in RecBC-
  • as above
      • as above
      • as above

Reduced recombination in RecBC-

Reduced recombination in RuvA-B-C-

Reduced recombination in RecG-

as above

as above

Reduced recombination

as above

as above

as above

slide11

Chi (Χ) site:

  • 8 base pair sequence without
  • symmetry (5’GCTGGTCC)
  • Greatly stimulates ability of RecBCD
  • to catalyze recombination

RecBCD exonuclease: opens strands

  • RecBCD binds to DNA at one end or at
  • a ds breakage point
  • Moves along the DNA, creating a loop
  • and degrading the strand with a free
  • 3’ end via its exonuclease activity
  • Exonuclease activity is inhibited
  • upon passing a Chi site of orientation
  • Upon cessation of exonuclease activity,
  • the undegraded 3’ end pairs with
  • homologous sequences on another
  • DNA molecule
slide12

RecA: needed to form triple helix

  • RecA binds to free strand to form an
  • extended helical structure.
  • Resultant DNA-RecA helix forms a
  • triple-stranded helix with ds DNA
  • that has a homologous region
  • one of the strands in the ds helix is
  • displaced (D loop)
  • displaced strand binds to original
  • complementary strand of the invasive
  • strand to create Holliday junction
slide14

RecF pathway

  • important for DNA repair
  • (i.e. UV light)
  • detectable as reduced
  • recombination in RecBC-
  • background
  • Important after heteroduplex
  • formation is initiated
  • branch migration
  • resolution of heterduplex

Proteins involved in DNA recombination (the E. coli paradigm) (con’t)

Mutation Phenotype

RecA

RecBC

RecD

RecF

RecJ

RecO

RecR

RecQ

RecN

RecG

RuvA

RuvB

RuvC

PriA

PriB

PriC

DnaT

Recombination deficient

Reduced recombination

Rec+  independent

Reduced plasmid recombination

  • Reduced recombination in RecBC-
  • as above
      • as above
      • as above

Reduced recombination in RecBC-

Reduced recombination in RuvA-B-C-

Reduced recombination in RecG-

as above

as above

Reduced recombination

as above

as above

as above

slide15

RuvB

RuvA

RuvC resolves (cuts) the Holliday junction

  • Ruv C is a specialized endonuclease
  • an X-phile – cuts crossed DNA strands
  • always cuts at two T’s

Efficient branch migration requires RuvA and RuvB

  • RuvA specifically binds Holliday junctions
  • - resultant structure better able to undergo branch migration and resolution
  • RuvB is a helicase
  • - forms a hexameric ring around the DNA strand
  • - DNA is pumped through the ring using ATP cleavage to drive the pump
  • - the synapse is thus forced to migrate
slide16

RuvA

RuvB

RuvB

A simple model of a RuvA/RuvB/DNA complex extrapolating from the above model and in agreement with the electron microscopy results of Parsons et al. (Nature 374, 375 (1995)). RuvA binds the Holliday junction at the central crossover point and targets two RuvB hexamers onto opposite arms of the DNA where they encircle the DNA duplexes and facilitate branch migration in concert with RuvA in an ATP dependent manner.

For animation, see http://www.sdsc.edu/journals/mbb/ruva.html

slide18

AmpR

EmR

b’

a

a’

b

Or

b’

EmR

a

a

a

a

5’ end

of gene

a

a

Single cross-over results in one truncated copy

and one intact copy of the gene

a

a

internal

fragment

Single cross-over results in an interrupted gene

a

b

a’

AmpR

slide19

a

a

a

a

Single cross-over outcome when using

one end of the gene

a

a

b

P2

P1

a

a

b

b

P1

a

a

P2

Useful for introducing a promoter-reporter gene fusion

without disrupting the gene’s function.

b

slide21

Example:

phage integrases

Example:

Salmonella flagellin

phase variation

Nonhomologous (Site-specific) Recombination

  • Occurs at specific or highly preferred target and donor DNA sequences
  • Requires special proteins that recognize specific sequences and
  • catalyze the molecular events required for strand exchange
  • Relatively rare compared to homologous recombination

Site-specific recombinases include:

- integrases recognize and promote recombination between

two sequences of DNA

- resolvases resolve co-integrates by pairing sequences within sites

that are present in direct orientation to each other

(example - transposon resolvases)

- invertases pair sequences within sites that

are present in reverse

orientation to each other

intermolecular

intramolecular

slide23

Examples of site-specific recombination

1) Phage integration and excision

  • Integration of circular phage
  • DNAinto the host DNA to
  • form a prophage occurs via
  • the action ofphage Int
  • enzymes (integrases).
  • Usually highly specific and
  • occurs at only one or a few
  • integration sites on the
  • chromosome
  • Excision utilizes both the
  • integrase and an excisase,
  • which act at the hybrid
  • integration sites that flank the
  • prophage
slide24

integrase

excisase

slide25

GCTTTTTTATACTAA

Phage integration and excision (con’t)

  • Lysogenization by lambda phage:
  • Site-specific recombination between the attP site on phage and
  • the attB site on bacterial chromosome
  • attP and attB are dissimilar except for 15 bp core sequence
  • GCTTTTTTATACTAA
  • The lambda Int protein is an integrase that promotes site-specific
  • recombination between 7 internal bases of the core sequence
  • Excision is via production on integrase (Int) and excisase (Xis), which promote
  • recombination of the hybrid attP/B and attB/P molecules in the chromosome
slide27

hin

H2 flagellin

Repressor

H1 flagellin

Examples of site-specific recombination (con’t)

2) Phase variation of Salmonella flagellin genes

  • Reversible, high frequency (10-4) inversion of DNA sequence that carries
  • the promoter for one flagellin structural gene and for a repressor of
  • a second flagellin gene
  • Occurs by virtue of a DNA invertase called Hin
    • Promotes site-specific recombination between two closely linked
    • sites of DNA

P

Inverted repeats