lori
Uploaded by
63 SLIDES
1178 VIEWS
660LIKES

Signal Transduction Pathways

DESCRIPTION

Signal Transduction Pathways. Signal Transduction Pathways. link cellular responses to plant hormonal signals environmental stimuli Binding of a hormone to a membrane receptor may stimulate production of second messengers

1 / 63

Download Presentation

Signal Transduction Pathways

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Signal Transduction Pathways

  2. Signal Transduction Pathways • link cellular responses to plant hormonal signals environmental stimuli • Binding of a hormone to a membrane receptor may stimulate production of second messengers • The activation of protein kinases, which in turn activate other proteins is a common component of signal transduction in plants • Hormones may enter the cell to bind with a receptor, and environmental stimuli can also trigger signal-transduction pathways

  3. Signal Transduction Components • Stimulus Hormones, physical environment, pathogens • Receptor On the plasmamembrane, or internal • Secondary messengers Ca2+, G-proteins, Inositol Phosphate • Effector molecules Protein kinases or phosphatases Transcription factors • Response Stomatal closure Change in growth direction

  4. Signal transduction Simplified model STIMULUS Plasma membrane R G-prot Ca2+ Phos Ca2+ Kin Nuclear membrane R TF DNA

  5. Light in Plants We see visible light (350-700 nm) Plants sense Ultra violet (280) to Infrared (800) Examples Seed germination - inhibited by light Stem elongation- inhibited by light Shade avoidance- mediated by far-red light There are probably 4 photoreceptors in plants We will deal with the best understood; PHYTOCHROMES

  6. The structure of Phytochrome A dimer of a 1200 amino acid protein with several domains and 2 molecules of a chromophore. Chromophore 660 nm 730 nm Pr Pfr Binds to membrane

  7. Signal Transduction of Phytochrome Membrane Pfr Ga G protein a subunit Pr Cyclic guanidine monophosphate Guanylate cyclase cGMP Ca2+/CaM Calmodulin CAB, PS II ATPase Rubisco FNR PS I Cyt b/f CHS Anthocyanin synthesis Chloroplast biogenesis

  8. -252 -230 -159 -131 +1 IV III II I Unit 1 5’-CCTTATTCCACGTGGCCATCCGGTGGTGGCCGTCCCTCCAACCTAACCTCCCTTG-3’ bZIP Myb Transcription Factors Light-Regulated Elements (LREs) e.g. the promotor of chalcone synthase-first enzyme in anthocyanin synthesis Promoter has 4 sequence motifs which participate in light regulation. If unit 1 is placed upstream of any transgene, it becomes light regulated.

  9. Light-Regulated Elements (LREs) • There are at least 100 light responsive genes (e.g. photosynthesis) • There are many cis-acting, light responsive regulatory elements • 7 or 8 types have been identified of which the two for CHS are examples • No light regulated gene has just 1. • Different elements in different combinations and contexts control the level of transcription • Trans-acting elements and post-transcriptional modifications are also involved.

  10. Plant growth regulators and their impact on plant development HormoneResponse (not a complete list) Auxin Abscission suppression; apical dominance; cell elongation; fruit ripening; tropism; xylem differentiation Cytokinin Bud activation; cell division; fruit and embryo development; prevents leaf senescence Gibberellin Stem elongation; pollen tube growth; dormancy breaking Abscisic Acid Initiation of dormancy; response to stress; stomatal closure Ethylene Fruit ripeningand abscission; initiation of root hairs; wounding responses

  11. CH3 CH3 CH3 OH COOH O CH3 Abscisic Acid (ABA) responsive genes ABA is involved in two distinct processes 1/ Control of seed development and germination 2/ Stress responses of the mature plant DROUGHT IN SALINITY A suite of stress response genes are turned on COLD The signal transduction pathway is still poorly understood but certain common regulatory elements have been found in the promoters of ABA responsive genes.

  12. ABA responsiveness GUS activity in the presence of ABA related to no ABA 1x 38x 24x 55x 87x Promoter studies of ABA responsive elements in Barley Section of the upstream region of a barley ABA responsive gene CCGGCTGCCCGCCACGTACACGCCAAGCACCCGGTGCCATTGCCACCGG -104 -56 (Shen and Ho 1997) Reporter gene (GUS) Minimal promoter

  13. ABA responsive elements GCCACGTACANNNNNNNNNNNNNNNNNNNNTGCCACCGG-------- ACGCGTCCTCCCTACGTGGC-----------------------------------

  14. Plant Disease Resistance • Importance of pests and pathogens • Complete v.s. partial resistance • Gene for gene theory • Cloned resistance genes • A model of Xa21, blight resistance gene • The arms race explained

  15. Complete and Partial Resistance There are two fundamentally different mechanisms of disease resistance. Partial Resistance horizontal resistance Not specific- confers resistance to a range of pathogens QUANTITATIVE Complete resistance vertical resistance Highly specific (race specific) Involves evolutionary genetic interaction (arms race) between host and one species of pathogen. QUALITATIVE

  16. Complete resistance Partial resistance Frequency % Frequency % Disease severity class Disease severity class Complete and Partial Resistance There are two fundamentally different mechanisms of disease resistance.

  17. Pathogen has virulence (a) and avirulence (A) genes Plant has resistance gene rr RR A a Gene-for-Gene theory of Complete Resistance If the pathogen has an Avirulence gene and the host a Resistance gene, then there is no infection

  18. Gene-for-Gene theory of Complete Resistance The Avirulence gene codes for an Elicitor molecule or protein controlling the synthesis of an elicitor. The Resistance gene codes for a receptor molecule which ‘recognises’ the Elicitor. A plant with the Resistance gene can detect the pathogen with the Avirulence gene. Once the pathogen has been detected, the plant responds to destroy the pathogen. Both the Resistance gene and the Avirulence gene are dominant

  19. Gene-for-Gene theory of Complete Resistance What is an elicitor? It is a molecule which induces any plant defence response. It can be a polypeptide coded for by the pathogen avirulence gene, a cell wall breakdown product or low-molecular weight metabolites. Not all elicitors are associated with gene-for-gene interactions. What do the Avirulence genes (avr genes) code for? They are very diverse! In bacteria, they seem to code for cytoplasmic enzymes involved in the synthesis of secreted elicitor. In fungi, some code for secreted proteins, some for fungal toxins.

  20. ELICITORS Elicitors are proteins made by the pathogen avirulence genes, or the products of those proteins Elicitors of Viruses Coat proteins, replicases, transport proteins Elicitors of Bacteria 40 cloned, 18-100 kDa in size Elicitors of Fungi Several now cloned- diverse and many unknown function Elicitors of Nematodes Unknown number and function

  21. Gene-for-Gene theory of Complete Resistance What does a resistance gene code for? The receptor for the specific elicitor associated with the interacting avr gene

  22. Protein structure of cloned resistance genes Pto tomato; bacterial resistance C N N Xa21 rice; bacterial resistance C N Hs1 sugar beet; nematode res. Cf9, Cf2 tomato; fungal resistance C N L6 flax; fungal resistance C RPS2, RMP1 Arabidopsis; bac. res. N tomato; viral resistance Prf tomato; bacterial resitance C N Transmembrane domain Conserved motif Leucine zipper domain DNA binding site Membrane anchor site Serine/threonine protein kinase domain Signal peptide Leucine-rich repeat

  23. Model for the action of Xa21 (rice blight resistance gene) Leucine-rich receptor Transmembrane domain Kinase Membrane Elicitor Signal transduction ([Ca2+], gene expression) Cell Wall Plant Cell

  24. The arms race explained An avirulence genes mutates so that it’s product is no longer recognised by the host resistance gene. It therefore becomes a virulence gene relative to the host, and the pathogen can infect. The host resistance gene mutates to a version which can detect the elicitor produced by the new virulence gene.

  25. Hypersensitive Reaction/Programmed Cell Death In response to signals, evidence suggests that infected cells produce large quantities of extra-cellular superoxide and hydrogen peroxide which may 1. damage the pathogen 2. strengthen the cell walls Oxidative 3. trigger/cause host cell death Burst Evidence is accumulating that host cell also undergo changes in gene expression which lead to cell death Programmed Cell Death

  26. Systemic Acquired Resistance Inducer inoculation Local acquired resistance 3 days to months, then inoculate Systemic acquired resistance SAR- long-term resistance to a range of pathogens throughout plant caused by inoculation with inducer inoculum

  27. Marker Assisted Selection • Targets for crop improvements • Genetics of improvement • Molecular mapping • Mapping a qualitative trait • Marker assisted selection for aroma in rice • Marker assisted selection for multiple resistant genes • Mapping quantitative traits • QTLs and marker assisted selection

  28. Targets for Improvement Targets for improvement in rice production fall into three categories Biotic constraints- (pests and diseases) Weeds, Fungi (e.g. Blast), Bacteria (e.g. Blight), Viruses (e.g. Rice yellow mottle virus), Insects (e.g. Brown plant hopper), Nematodes (e.g. Cyst-knot nematode) Abiotic constraints (adverse physical environment) Drought, Nutrient availability, Salinity Cold, Flooding Yield and quality Plant morphology, Photosynthetic efficiency, Nitrogen fixation, Carbon partitioning, Aroma

  29. Genetics of improvement Biotic constraints- Qualitative (complete resistance) Quantitative (partial resistance) Abiotic constraints- Quantitative (mostly) Yield and quality- Qualitative (aroma, partitioning) Quantitative (morphology, partitioning) Requires genetic engineering (photosynthesis, n. fixation)

  30. Marker Assisted Selection Useful when the gene(s) of interest is difficult to select for. 1. Recessive Genes 2. Multiple Genes for Disease Resistance 3. Quantitative traits 4. Large genotype x environment interaction

  31. Molecular Maps Molecular markers (especially RFLPs and SSRs) can be used to produce genetic maps because they represent an almost unlimited number of alleles that can be followed in progeny of crosses. Chromosomes with morphological marker alleles Chromosomes with molecular marker alleles RFLP1b RFLP1a RFLP2a RFLP2b SSR1b SSR1a RFLP3b RFLP3a T t SSR2b SSR2a r R RFLP4b RFLP4a or

  32. Molecular map of cross between rice varieties Azucena and Bala. Mapping population is an F6 1 2 3 4 5 6 51 cM 54 cM 54 cM 51 cM 7 8 9 10 11 12 48 cM MOLECULAR MAPS CAN BE USED TO LOCATE GENES FOR USEFUL TRAITS (CHARACTERISTICS)

  33. To locate useful genes on chromosomes by linkage mapping, you need 1. A large mapping population (100 + individuals) derived from parental lines which differ in the characteristic or trait you are interested in. 2. Genotype the members of the population using molecular markers which are polymorphic between the parents (e.g. RFLPs, AFLPs, RAPDs) 3. Phenotype the members of the population for the trait making sure you asses each individual as accurately as possible

  34. What is an F6 mapping population? Azucena x Bala F1 (self) 1 Individual F2 F2 F2 F2 F2 (self)205 individuals F3 F3 F3 F3 F3 (self)205 individuals F4 F4 F4 F4 F4 (self)205 individuals F5 F5 F5 F5 F5 (self)205 individuals F6 F6 F6 F6 F6 205 families Single Seed Decent Seed multiplication

  35. R642 RZ141 G320 G44 RG2 C189 G1465 Rice chromosome 11 Making A Linkage Map Genotype No. of G320 RG2 C189 Individuals A A A 47 A A B 8 A B A 5 A B B 15 B A A 19 B B A 24 B A B 3 B B B 42 . Total 163 Recombinants between G320 and RG2 = 5 + 15 + 19 + 3 = 42 = 26% Recombinants between RG2 and C189 = 8 + 5 + 24 + 3 = 40 = 25% Recombinants between G320 and C189 = 8 + 15 + 19 + 24 = 66 = 40%

  36. A A A G320 RG2 C189 A A A B B A B B A Frequency of Genotype 47 8 5 15 19 24 3 42 Making a Linkage Map

  37. Segregation of disease resistance in population 0 1 2 3 4 5 6 7 8 9 Disease Severity Class Mapping a Qualitative Trait e.g. disease resistance For a complete resistance gene, one parent is resistant, the other is susceptible The individuals in the segregating population are either resistant or susceptible.

  38. Disease resistant individuals for each genotype 0% 0% 80% 87% 37% 100% 0% 100% 11 R642 RZ141 G320 G44 RG2 C189 G1465 Blast resistance gene Mapping a Qualitative Trait

  39. Marker Assisted Selection for Aroma in Rice The variety Azucena is aromatic (i.e. it smells pleasant and it’s seeds smell and taste pleasant) Therefore Azucena rice fetches a higher price The aroma gene is recessive. Therefore, it can’t be followed in backcross breeding. The gene for aroma has been mapped to chromosome 8 Kalinga III is a popular variety in Eastern India but it is not aromatic. The aroma gene of Azucena has been crossed into Kalinga III by selection for RFLPs linked to the aroma gene

  40. Non-selected BC1 Selected BC1 Kalinga III Azucena F1 Chromosome 8 Non-selected BC1 G1073 Selected BC1 Kalinga III Azucena R2676 F1 Marker Assisted Selection Using molecular markers as selection criteria rather than the gene you want to transfer Aroma gene flanked by G1073 and R2676

  41. Marker Assisted Selection in Disease Resistance Resistance genes can be selected for by screening with the disease. So, conventional breeding can produce resistant varieties. But, resistance genes break-down. The disease organism mutates to overcome them (in 2-3 years). If there were several resistance genes, the disease organism would take very much longer to overcome all resistance genes (in fact it is virtually impossible). But, you can’t select for say 3 resistance genes conventionally- you can’t tell the difference between 1 gene and 2 or 3 by phenotype. But if you select for markers linked to the resistance genes, you can introduce multiple resistance genes.

  42. Marker Assisted Selection in Disease Resistance Selectable markers Elite variety Donor1 Donor 2 Donor 3 Multiple crosses followed by backcrossing with selection for markers at every stage Elite variety with multiple resistance genes

  43. 11 R642 RZ141 G320 G44 200 250 300 350 400 450 500 550 600 650 Max. Root Length Class (mm) RG2 C189 G1465 Mapping a Quantitative Trait e.g. rooting depth Root length gene

  44. 200 250 300 350 400 450 500 550 600 650 Max. Root Length Class (mm) Mapping a Quantitative Trait e.g. rooting depth Difference between parents is 360 mm Difference between genotype classes at RG2 is 50 mm This locus accounts for 16% of the difference

  45. Quantitative trait loci (QTLs) and Marker Assisted Selection QTLs (the location of a gene contributing to a quantitatively variable trait) are difficult to select for conventionally; it is very difficult to identify individuals with the QTL from those without because its effect is small. Marker assisted selection can be used once markers at the QTL have been found. Multiple QTLs can be combined for greater effect.

  46. 1 2 3 4 5 6 51 cM 54 cM 54 cM 51 cM 7 8 9 10 11 12 48 cM Azucena QTLs targeted in the Marker Assisted Selection to improve the root system of Kallinga III

  47. Genetic Engineering Genetic transformations Agrobacterium transformations Direct transfer methods for transformation Transformation cassettes From transformed cells to plants The use of transformed plants in research Mutants Transposon Transposon and T-DNA tagging

  48. T-DNA (transfer) Restrict and ligate together Foreign DNA T-DNA (transfer) Re-introduce recombinant DNA Genetic Engineering of Plants- Agrobacterium transformation- The bacteria Agrobacterium tumefaciens causes galls or tumors on plants Ti Plasmid (tumor inducing) Genomic DNA

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer