by amira el srougy shweta bhargava jhelum naik rahul patil n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
BY: Amira El-Srougy Shweta Bhargava Jhelum Naik Rahul Patil PowerPoint Presentation
Download Presentation
BY: Amira El-Srougy Shweta Bhargava Jhelum Naik Rahul Patil

Loading in 2 Seconds...

play fullscreen
1 / 15

BY: Amira El-Srougy Shweta Bhargava Jhelum Naik Rahul Patil - PowerPoint PPT Presentation


  • 252 Views
  • Uploaded on

Comparison of SNP distribution in Human and Mouse. BY: Amira El-Srougy Shweta Bhargava Jhelum Naik Rahul Patil. Methodology. Statistical Results from the data. HOMOLOGENE Structurally Similar Genes. dbSNP To find SNP for each Gene. SNP data for Human and Mouse.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'BY: Amira El-Srougy Shweta Bhargava Jhelum Naik Rahul Patil' - lorenzo-romero


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
by amira el srougy shweta bhargava jhelum naik rahul patil

Comparison of SNP distribution in

Human and Mouse

BY:

Amira El-Srougy

Shweta Bhargava

Jhelum Naik

Rahul Patil

methodology
Methodology

Statistical

Results from the data

HOMOLOGENE

Structurally Similar Genes

dbSNP

To find SNP for each Gene

SNP data for Human and Mouse

LALIGN

Find local alignment between mRNA sequences

SNP comparison results from the program

snp density
SNP density
  • Human : 335
  • Mouse : 1877
snp density in exon
SNP density in Exon
  • Human : 612
  • Mouse : 1078
snp density in intron
SNP density in Intron
  • Human : 328
  • Mouse : 1962
how to compare snps
How to Compare SNPs?
  • To test for SNP with in a species is easier..
  • Sequence are almost 99% similar

AAGAC G ATAGTACG

AAGAC ? ATAGTACG

snp comparison two models
SNP Comparison.. Two Models
  • Compare the SNP signatures.
  • Align the mRNA sequences of the two homologus genes.
snp signature
SNP signature
  • For a mRNA of length 5000 the 7 letter sequence would be unique because..
  • .257 * 5000 = .3
  • AGACTGACTGATCGTTAAGCTTG

CTGATCG

ATCGTTA

GTTAAGC

alignment method
Alignment Method
  • Pair wise alignment between mRNA of Homologus genes.
  • Search for the Conserved SNPs in the alignment.
  • Local or Global Alignment ?
alignment method1
Alignment Method
  • Read in the start point (nucleotide position) of the alignments from the given input file
  • Read in the SNPs locations for both human and the mouse from the given input file
  • Read in the number of total coding SNPs in human and mouse from the given input file
  • Find the relative distance between the starting point of the alignment and the SNP
  • Compare if the SNPs in humans and mouse occur at the same relative position.
  • If they occur at the same position and their alleles are the same, then the SNP is said to be conserved.
are snps conserved
Are SNPs Conserved?
  • None of the SNPs tested were found to be conserved.