diagnostic d une infection bacterienne l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
DIAGNOSTIC D'UNE INFECTION BACTERIENNE PowerPoint Presentation
Download Presentation
DIAGNOSTIC D'UNE INFECTION BACTERIENNE

Loading in 2 Seconds...

play fullscreen
1 / 55

DIAGNOSTIC D'UNE INFECTION BACTERIENNE - PowerPoint PPT Presentation


  • 829 Views
  • Uploaded on

DIAGNOSTIC D'UNE INFECTION BACTERIENNE. Généralités. DIAGNOSTIC DIRECT : mise en évidence de la bactérie elle-même, donc finalement de sa culture ou isolement qui permettra l'identification ultérieure ainsi que de préciser sa sensibilité aux antibiotiques (antibiogramme).

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

DIAGNOSTIC D'UNE INFECTION BACTERIENNE


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
    Presentation Transcript
    1. DIAGNOSTIC D'UNE INFECTION BACTERIENNE

    2. Généralités • DIAGNOSTIC DIRECT : mise en évidence de la bactérie elle-même, donc finalement de sa culture ou isolement qui permettra l'identification ultérieure ainsi que de préciser sa sensibilité aux antibiotiques (antibiogramme). • DIAGNOSTIC INDIRECT : mis en évidence de la réponse de l'organisme à l'infection par la présence d'anticorps spécifiques, le plus souvent sériques ou plus rarement par une réponse d’hypersensibilité, dite allergique.

    3. Examen direct : Demande • Important: Identification du patient par son nom, son prénom, sa date de naissance... • Il existe une procédure standard de recherche de cellules et de germes, d'où l'appellation suivante : "Examen cytobactériologique des urines ou ECBU". • Le clinicien ne devra jamais oublier d'indiquer toute demande ou recherche particulière, en raison de l'utilisation de milieux spéciaux.

    4. Examen direct : Examen macroscopique • Toute infection bactérienne s'accompagne, outre la présence de bactéries, de signes biologiques liés à l'inflammation avec l'éventuelle présence de leucocytes. • Ces éléments peuvent entrainer au delà d'un seuil, une modification visuelle, clairement perceptible à l'oeil nu, qui signe une anomalie patente. Divers éléments sont alors obtenus comme le montrent les exemples suivants: • Trouble, hématurique, coloration anormale, odeur et consistance.

    5. Examen direct : Examen microscopique, état frais • Etat frais: • une préparation est obtenue avec le dépôt d'une goutte entre lame et lamelle, puis on observe au microscope: • Présence éventuelle de bactéries (coque, diplocoque, chainette, coccobacille, bacille...), • le type de mobilité. • Evaluation des cellules avec une appréciation semi-quantitative (rares, peu nombreux, nombreux, très nombreux...) ou mieux quantitative, exprimée par nombre d'éléments / mm3 ou ml.

    6. Examen direct : Examen microscopique, après coloration • Coloration de Gram permet de distinguer les bactéries colorées en violet (G+) de celles en rose (G-).

    7. Examen direct : premières conclusions • Les éléments récoltés de l'examen macroscopique et surtout microscopique fournissent souvent des arguments diagnostiques de très forte présomption. • La culture ou l'isolement de l'agent causal sera, cependant, essentielle. Elle permettra l'identification ultérieure mais aussi de préciser sa sensibilité aux antibiotiques (Antibiogramme). • Le diagnostic indirect sera quelquefois le seul recours diagnostique possible dans quelques maladies comme la syphilis.

    8. Culture - Isolement • Divers milieux sont utilisés qui doivent satisfaire les besoins nutritifs et énergétiques des bactéries à cultiver. • En pratique, sont utilisés plusieurs milieux solides (gélosés) avec une technique particulière d'ensemencement (isolement orthogonal ou en cadran) permettant l'isolement de clones bactériens sous la forme de colonies (de l'ordre de 106 bactéries).

    9. Culture: Exemples de milieux solides coulés en boîte de pétri selon le produit pathologique et la demande • Pus, liquides de ponction : milieux enrichis au sang, milieu sélectif (Chapman, ou sur demande: Loewenstein-Jensen) • Expectoration : milieux enrichis au sang (frais, cuit), milieu sélectif (Chapman; Drigalski ou sur demande: Lowenstein-Jensen) • Urines : milieu sélectif (Drigalski), milieu polyvalent pour bactéries G+ et G- . • Selles (coproculture): milieux sélectifs (Drigalski et SS pour entérobactéries telles Salmonella et Shigella,

    10. Culture: Exemples de milieux liquides • L'usage de milieux liquides est limité en raison de l'absence possible d'isolement. • Sang, pus, liquides de ponction : milieux enrichis (flacons pour hémoculture,..... • Selles (coproculture): milieu sélectif (Muller-Kauffman).

    11. Culture : Incubation • Après ensemencement, mise en incubation dans une étuve ou une chambre chaude à 37°C: • en atmosphère ambiante (culture aérobie), • en l'absence d'oxygène (culture anaérobie.

    12. Culture : délai d’incubation • De très nombreuses espèces bactériennes cultivent après 18 à 24 H d'incubation à 37°C. • D'autres espèces ont des délais d'incubation plus longs telles Mycobacterium tuberculosis (temps moyen d'isolement de l'ordre de 21 jours) • Les cultures sont examinées en notant la quantité de colonies obtenues de manière : • Semi-quantitative (rares, peu nombreuses, nombreuses, très nombreuses) pour les liquides de ponction. • Quantitative (104, 105, 106 ..../ml) pour les prélèvements urinaires et pulmonaires. • Autres éléments pris en compte sont : • Culture en aérobiose et/ou en anérobiose. • Aspect des colonies: la taille, la bordure et la coloration Présence d'une hémolyse (alpha, béta).

    13. Culture : exemple d’isolement Pus sur une gélose au sang frais

    14. Culture : Identification - Antibiogramme • L'identification et l'antibiogramme de la majorité des bactéries habituelles est alors précisé dans un délai de 18-24 h. • A l'aide de tests d'orientation rapide : oxydase, catalase, coagulase... • Par ensemencement d'une galerie biochimique adaptée : • Identification de Escherichia coli et Proteus mirabilis par un ensemble de réactions du métabolisme intermédiaire.

    15. Quelquefois cette procédure est insuffisante pour l'identification d'une bactérie • Il convient de faire appel : • soit à des modalités classiques de recherche d'autres caractères bactériens tels la croissance sur certains milieux pour l'identification des sources de carbone permettant la croissance, le type respiratoire, le type fermentaire, le type antigénique… • soit à des modalités modernes telles l'amplification génique de certains gènes ou encore le séquencage d'autres (ARNr 16S).

    16. Les autres moyens diagnostiques Produits bactériens

    17. Recherche d'antigène soluble • Exemple d'une pneumopathie à Legionella pneumophila. • Le test immunochromatographique aide au diagnostic présomptif des infections à Legionella en parallèle avec la culture ou d'autres tests.  • Les avantages de ce test sont : précocité (dès le début des signes), simplicité (sur urine), rapidité (en 30 minutes), diagnostic tardif (> 2 mois après les signes cliniques), même après un traitement antibiotique adapté, Donc bonne valeur prédictive mais ce test ne détecte pas les autres sérogroupes de L. pneumophila

    18. Méthode moléculaire • Le principe en est simple puisqu'il consiste à amplifier un gène entier ou non avec des amorces spécifiques ou encore séquencé et comparé avec ceux déposés dans des banques. • L'intérêt de ces diverses méthodes se résume: • Gain de sensibilité (X 2 par rapport aux méthodes classiques) pour la recherche notamment des Chlamydia génitaux. • Simplicité et la rapidité d'exécution.

    19. Biologie moléculaire : PCR = "Polymerase chain reaction" ou l'amplification génique • La PCR est la technique la plus utilisée pour la détection (amplification) de l’ADN et de l’ARN. • A partir d’une simple copie d’une séquence particulière d’acides nucléiques, cette séquence peut être spécifiquement amplifiée et détectée. • Couramment utilisée pour le diagnostic à partir du produit pathologique de germes de culture difficile, voire impossible, tel Chlamydia trachomatis. Un appareil de PCR et la révêlation UV d'un produit amplifié après électrophorèse sur gel.

    20. EXTRACTION DE L’ADN BACTERIEN 1. Lyse des bactéries 2. Fixation de l ’ADN sur des billes de silice 3. Lavages 4. Elution de l ’ADN par de l ’eau ou du tampon

    21. EXTRACTION DE L ’ADN BACTERIEN EXTRACTION AUTOMATISEE SUR MAGNAPURE

    22. DETECTION DE L’ADN AVEC DES SONDES D’HYDROLYSE TAQMAN R = reporter et Q = quencher Dénaturation de l’ADN à 95 °C La sonde se fixe vers 68-72 °C Les amorces se fixent vers 60 °C La Taq ajoute des nucléotides et détruit la sonde. Le reporter se retrouve dans le milieu et émet une fluorescence qui est détectée.

    23. AMPLIFICATION PAR PCR Marqueur Témoin positif Marqueur de poids moléculaire Témoin négatif Echantillons

    24. Biologie moléculaire : Séquençage • ADN: Séquence de 4 nucléotides • Purines: Adénine (A), Guanine (G) • Pyrimidines: Cytosine (C ), Thymine (T)

    25. Matériel génétique Chromosome Noyau Cellule ADN

    26. Chromosome Noyau L’information génétique est stockée dans les chromosomes Cellule ADN Un chromosome est comme une pelote de laine dont le fil est l’ADN

    27. Chromosome Noyau Cellule A T G C T A A ADN T Un chromosome est comme une pelote de laine dont le fil est l’ADN

    28. Chromosome Noyau Cellule A T G C T A A ADN T L’ADN est une chaîne composée de 4 « molécules » différentes symbolisées par les lettres AT G C

    29. Chromosome 3 milliards de « caractères »… Noyau tgctgccatctacatttttgggactcgggaattatgtgagtaccgaaactactta gcttatggtaggtgtaccacacgcacagggaaagaattgcgtttatgtgggacag tgaaaacaatcgcaaaaaagcaatggaaagggctttgagagtaatttatcttctg acatatgcaatatggcaacttctaaatggtgagagggagtctctctaaagcaatc atttgaagattggttggacaaacaatgggaaagtcattgtcttagcagaattaag tcatactttttttttttttttttttttgctaactctagaagcttttctgttatct ctgtagctcagacgaaaatgcattctcaccagatgactgtttttggttaatcgat ctgaatgcgctttgtgtggactgtcgaatttcaaagatttaccgtatgaccaaga gcacctgatgctacaagtataaataggggaacaaatgctttctgttcttcctcgg taaggaggtagaggtggaggcggagccggatgtcagaggtcctgaaatagtcacc tgggggaaaatgatccgcctgctgttgaagcccccttctcattccgatcgctttt ggccttgatgatttgaaaataagtcctgttgcaccaggtaagtggacccaggtga gactctgtgatttctgcccataccctcatgtaggtgaccaatgtgactagctgtc ctgtgggggaaatatctccccagccattctgacacccacaggctggacacctgca ttccctagatctgcagaatctcagggagaaggggcattggagaggggatcgtttc ttaagccctttgctctctccctggagaccggtgttttcttctcttgttggaggtt tcagagactggggctccacaattgtcctgtcaatcctgaaggaggtcagatcctg gccaggaaatctctgagtcctccaggaagtcctgagaagcagtggccac Cellule A A T T G G C C T T A A A A ADN T T C

    30. une séquence d’ADN… tgctgccatctacatttttgggactcgggaattatgtgagtaccgaaactactta gcttatggtaggtgtaccacacgcacagggaaagaattgcgtttatgtgggacag tgaaaacaatcgcaaaaaagcaatggaaagggctttgagagtaatttatcttctg acatatgcaatatggcaacttctaaatggtgagagggagtctctctaaagcaatc atttgaagattggttggacaaacaatgggaaagtcattgtcttagcagaattaag tcatactttttttttttttttttttttgctaactctagaagcttttctgttatct ctgtagctcagacgaaaatgcattctcaccagatgactgtttttggttaatcgat ctgaatgcgctttgtgtggactgtcgaatttcaaagatttaccgtatgaccaaga gcacctgatgctacaagtataaataggggaacaaatgctttctgttcttcctcgg taaggaggtagaggtggaggcggagccggatgtcagaggtcctgaaatagtcacc tgggggaaaatgatccgcctgctgttgaagcccccttctcattccgatcgctttt ggccttgatgatttgaaaataagtcctgttgcaccaggtaagtggacccaggtga gactctgtgatttctgcccataccctcatgtaggtgaccaatgtgactagctgtc ctgtgggggaaatatctccccagccattctgacacccacaggctggacacctgca ttccctagatctgcagaatctcagggagaaggggcattggagaggggatcgtttc ttaagccctttgctctctccctggagaccggtgttttcttctcttgttggaggtt tcagagactggggctccacaattgtcctgtcaatcctgaaggaggtcagatcctg gccaggaaatctctgagtcctccaggaagtcctgagaagcagtggccac Chez l’homme, L’information génétique est formée par un texte de 3 milliards de caractères unique pour chaque individu: « le génome humain »

    31. Chromosome Noyau Cellule ADN Un gène

    32. mRNA virtuel Traduction en ‘protéine’

    33. Séquençage de l’ADN • Définition : • Technique permettant de déterminer la séquence (ordre des nucléotides) d’une molécule d’ADN.

    34. Polymérase Séquençage selon Sanger • Polymérisation de l’ADN 5’ATGGCTATGCCGAGACCATATTACGACCAG 3’ 3’TACCGATACGGCTCTGGTATAATGCTGGTC 5’ Nucléotides (dNTP) A G T C C G A C G Amorce Matrice

    35. Didésoxyribo-nucléotides Désoxyribo-nt Didésoxyribo-nt 5’ 1’ 4’ 3’ 2’

    36. Polymérase Séquençage selon Sanger • Réaction de séquençage (ddGTP) 5’ATGGCTATGCCGAG 3’TACCGATACGGCTCTGGTATAATGCTGGTC 5’ dNTP + ddGTP Amorce A G T C G C A C G Matrice

    37. Séquençage selon Sanger • Réaction de séquençage (ddGTP) 5’ATGGCTATG 3’TACCGATACGGCTCTGGTATA 5’ 5’ATGGCTATGCCG 3’TACCGATACGGCTCTGGTATA 5’ 5’ATGGCTATGCCGAG 3’TACCGATACGGCTCTGGTATA 5’

    38. Séquençage selon Sanger • Séparation des produits Electrode - 5’ATGGCTATGCCGAG 5’ATGGCTATG 5’ATGGCTATGCCG Electrophorèse Gel d’Agarose Migration Electrode +

    39. 3’ AGGCTATCTGAC 5’ Séquençage selon Sanger ddA ddG ddC ddT Electrode - Gel d’Agarose Migration Electrode +

    40. Séquençage automatique Ordinateur

    41. Séquençagenucléotide : méthode de Sanger • Liaison de l’amorce avec l’ADN à séquencer. • La fixation des ddNTP (désoxyNucléotide TriPhosphate) aux brins d’ADN va créer des brins de différentes tailles. • Les brins vont migrer sur un gel d’électrophorèse selon leur taille : le plus petit migre le plus vite.

    42. Séquençagenucléotide : méthode de Sanger

    43. Séquençagenucléotide : méthode de Sanger • Automatisation de la méthode : • Ajout sur les ddNTP de fluorochrome de différentes couleurs. • 1 seul tube regroupant les ddNTP. • Lecture par un laser des fragments qui migrent sur le gel. • Stockage des données dans la mémoire de l’ordinateur.

    44. Séquençagenucléotide : méthode de Sanger

    45. Séquençagenucléotide : méthode de Sanger

    46. Diagnostic indirect ou sérologique • Le principe se base sur les conséquences induites chez l'hôte à savoir la production d'anticorps. • La réaction immunitaire ne se développe qu'à partir d'un délai, de l'ordre de 8 à 10 jours. • Techniques : Les anticorps sont recherchés, le plus souvent, dans le sang circulant après prise de sang, de l'ordre de 5 à 10 ml sur tube sec sans anti-coagulant. • Il existe diverses techniques pour déceler la présence d'anticorps: • Réaction d'agglutination. • Recherche d'anticorps par ELISA. • Recherche d'anticorps par immunofluorescence. • Recherche d'anticorps par une technique de révêlation utilisant les globules rouges

    47. Une protéine: comment c’est fabriqué ?

    48. Noyau de la cellule = Bibliothèque Une cellule Chromosomes (ADN) = Livres de recettes (23 x 2 chez l’homme)

    49. Noyau = Bibliothèque Une cellule Chromosomes (ADN) = Livres de recettes 1 recette pour 1 protéine = 1 gène

    50. Noyau = Bibliothèque Chromosomes (ADN) = Livres Une cellule 1 gène = 1 recette Photocopie de la recette (ARN)