slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Genome organization & its genetic implications PowerPoint Presentation
Download Presentation
Genome organization & its genetic implications

Loading in 2 Seconds...

play fullscreen
1 / 43

Genome organization & its genetic implications - PowerPoint PPT Presentation

  • Uploaded on

Genome organization & its genetic implications. Lander , ES (2011) Initial impact of the sequencing of the human genome. Nature 470:187 Feuillet, C, JE Leach, J Rogers, PS Schnable , K Eersole (2011) Crop genome sequencing: lessons and rationales. Trendt Plant Sci 16:77.

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

PowerPoint Slideshow about 'Genome organization & its genetic implications' - lerato

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Genome organization


its genetic implications

Lander , ES (2011) Initial impact of the sequencing of the human genome. Nature 470:187

Feuillet, C, JE Leach, J Rogers, PS Schnable, K Eersole (2011) Crop genome sequencing: lessons and rationales. Trendt Plant Sci 16:77


DNA sequencing technologies

Metzker, M (2010) Sequencing technologies – the next generation. Nature Rev Genet 11:31


What are the challenges for the correct assembly of genome sequence information?

  • Genome size
    • Eukaryotic genomes ~ 109 – 1010bp
  • Genome composition
    • Eukaryotic genomes ~ 50 % repetitive DNA

Genome size – the C-value paradox

genome size in basepairs


Genome Size – the C value paradox:

The amount of DNA in the haploid cell of an organism is not related to its evolutionary complexity or number of genes


Genome composition

  • Complexity = length in nucleotides of longest non- repeating sequence that can be formed by splicing together all unique sequence in a sample
  • Eukaryotic genomes contain different classes of DNA based on sequence complexity:
        • highly repetitive
        • middle repetitive
        • unique
genome composition dna re association kinetics
Genome composition – DNA re-association kinetics

complexity in

[moles of nucleotide / liter] x sec


Genome composition - DNA re-association kinetics for a complex eukaryotic genome

highly repetitive sequences

middle repetitive sequences

single copy


[moles of nucleotide / liter] x sec


From genome composition to genome organization

  • How are unique, middle repetitive and highly repetitive sequences organized in the genome?

Genome organization

E. coli

S. cerevisiae

H. sapiens

gene island

Z. mays

gene desert

= Gene

= Repeat


Genetic complexity

  • Eukaryotic genomes contain ~ 20,000 – 30,000 genes
  • 30% of protein coding genes are members of gene families
      • duplication & divergence of sequence & gene
      • function

Gene complexity

  • What does a gene look like from a sequence or transcript perspective?
        • no “typical gene”
  • Introns and exons
        • introns can be numerous and long, i.e. some genes are more intron than exon!
        • alternative splicing variants are common
  • Not all genes encode proteins
        • non-coding structural RNAs (e.g. rRNA, tRNA, snRNA, snoRNA)
        • non-coding regulatory RNAs (e.g. miRNA, lncRNA)

Implications of gene and genetic complexity

  • Forward genetics: Have mutant – want gene
  • Via map-based cloning:
      • Map your mutation
      • Look at the genome sequence in the map interval to identify candidate genes
  • Candidate gene identification may not be trivial, even with good genome annotation!
    • Especially an issue for plant genome sequences – only arabidopsis and rice are considered “finished” quality
  • Note further genetic tests required, even if the perfect candidate is identified.

Gene identification - open reading frames


frame 1

atgcccaagctgaatagcgta gag gggttttcatcataa

M   P   K   L   N   S   V   E   G   F S S *

frame 2  

tgcccaagctgaatagcg tag aggggtttt cat cattgg

C   P   S   *   I   A   *   R   G   F H H

  • How to tell real orfs from random chance orfs?

Gene identification - short orfs can be translated!

  • e.g. the drosophila tarsal-less gene

Galindo et al.

PLoSBiol 5(5): e106 doi:10.1371/journal.pbio.0050106


Gene identification – database searching



Gene identification – shared


Preserved localization of genes on chromosomes of different species

e.g. mouse chromosome 11 and parts of 5 different human chromosomes

Perfect correspondence in order, orientation and spacing of 23 putative genes, and 245 conserved sequence blocks in noncoding regions

Caution! Even regions of high synteny may not show perfect gene-for-gene correspondence

from Gibson & Muse (2002) A Primer of Genome Science,Sinauer Inc.


Gene identification – shared synteny

Preserved localization of genes on chromosomes of different species

e.g. maize – sorghum (G) -

rice (H)

Schnable et al.

Science 326:1112


Gene identification – promoter elements

  • TATA – box elements
      • 5'-TATAAA-3' or variant
      • plant and animal promoters
  • CpG islands
      • Regions of higher than expected CpGdinucleotidecontent, un-methlylated in active promoters
      • ~ 40% of mammalian promoters
      • ~ 70% of human promoters
      • but NOT in plant promoter regions
  • Y patch (pyrimidine-rich patch)
      • plant not mammalian promoters

Gene identification – introns & exons

  • Long gene space more intron than exon
  • Extreme example - human clotting factor VIII gene

Gene identification – non-coding RNAs

  • non-coding structural RNAs
      • rRNA & tRNA – transcription & translation
      • snoRNA – small nucleolar RNAs
        • guide chemical modification of rRNAs & tRNAs
      • snRNA – small nuclear RNAs
        • guide splicing reactions
  • non-coding regulatory RNAs
      • miRNA & siRNA - small interfering RNAs
        • RNAi pathway
      • lncRNA - long noncoding RNAs

Origins of long non-coding RNAs

  • Overlapping transcriptional architecture
    • e.g. the human phosphatidylserinedecarboxylase (PISD) gene

Kapranov, Nature Rev Genet 8:413


Functions of lncRNAs

Wilusz et al. Genes Dev. 23: 1494–1504


Genome -Transcriptome - Proteome

  • Genome
      • Full complement of an organism’s hereditary information
  • Transcriptome
      • Full set of RNA molecules, coding and non-coding, transcribed from the genome
  • Proteome
      • Full set of proteins expressed from a genome
  • Not a 1:1:1 correspondence

Implications of gene and genetic complexity

  • What is the take-home message for forward genetics?

Implications of gene and genetic complexity

  • Reverse genetics: Have gene – want phenotype
    • Predict phenotypes based on gene function in other organisms
    • Knock out or knock down your gene of interest & look for corresponding changes in phenotype

Gene families

  • Gene duplication followed by:
    • Duplication of gene function
    • Divergence of gene function
    • Loss of gene function leading to a pseudogene
  • e.g. human
    • globin gene
    • family

Gene families

  • Gene duplication followed by:
    • Duplication of gene function
    • Divergence of gene function
    • Loss of gene function leading to a pseudogene
  • e.g. human beta-globin gene cluster
    • chromosome 11
    • Five functional genes and two pseudogenes

Gene families – paralogs & orthologs

  • Homologs
    • Protein or DNA sequences having shared ancestry
  • Orthologs
    • Homologs created by a speciation event
    • May or may not retain the same function!
  • Paralogs
    • Homologs created by a gene duplication event
    • May or may not retain the same function!
  • It is not always easy or possible to distinguish orthologs from paralogs when comparing genes or proteins between species

Gene families – paralogs & orthologs





Storz et al. IUBMB Life 63:313


Implications of gene and genetic complexity

  • What are the implications of gene families for forward genetics (i.e. looking for candidate genes that condition a mutant phenotype?)
  • What are the implications of gene families for reverse genetics (i.e. altering gene function and looking for a phenotype)?

Genome organization – repeated sequences ~ 50% of the genome

  • Segmental duplications and copy number variation
  • Tandemly repeated genes
    • rRNA, tRNA and histone gene products needed in large amounts
  • Duplicated gene families
  • Transposons
  • Tandem simple sequence repeats
    • centromeric & telomeric repeats
    • minisatellites
    • microsatellites

Repeated sequences – segmental duplications & copy number variants

  • Segmental duplications
    • > 1 kb block of duplicated sequence with > 90% sequence identity
    • recombine to mediate further copy number variants

Koszul & Fischer, C.R. Biologies 332:254


Repeated sequences – segmental duplications & copy number variants

  • Copy number variant (CNV)
    • Deviation from diploid
    • copy number at a locus
  • Copy number polymorphism (CNP)
    • CNV present in >1% of a
    • population
  • Recent association with human developmental syndromes

Girirajan et al. Annu Rev Genet 45:203


Transposon-derived repeated sequences

  • ~ 45% of human & 85% of maize genome

Transposon-derived repeated sequences

  • Many are truncated & inactive
  • Considered to be important in the
    • evolution of genome organization
    • & function

Gogvadze & Buzdin

Cell Mol Life Sci 66:3727


Repeated sequences – short tandem repeats

  • Centromeric
    • Long array (~100,000 bp) of short tandemrepeats
      • ~ 5bp drosophila, ~150 bp maize, ~170 bp human
    • not conserved across species
    • in some cases not even conserved in all chromosomes of the same species
    • Association with a centromere-specific histone H3
  • Telomeric
    • Length varies between species
      • ~ 300 base pairs - 150 kilobasepairs
    • Conserved, G-rich repeat sequence
      • vertebrates TTAGGG ; most plants TTTAGGG

Repeated sequences – short tandem repeats

  • Minisatellites (Variable number tandem repeats, VNTRs)
    • 10-100 bp repeat units
    • 500-30,000 bp arrays
    • The original DNA fingerprinting marker via Southern blotting
        • Now supplanted by microsatellites

variety A

variety B





  • Repeated sequences – short tandem repeats
  • Microsatellites (Simple sequence repeats, SSRs)
    • Di, tri or tetra-nucleotide repeats; 1-10 repeat units per locus
    • Repeat numbers expand or contract over a short evolutionary, or even generational time-frame
    • Amplified by PCR
      • Primers based on unique flanking sequence
      • Products fractionated by capillary or acrylamide gel electrophoresis
    • Co-dominant mapping & fingerprinting markers
      • Both alleles can be detected in a heterozygous individual