Schizophrenia and Other Human Psychiatric Diseases Challenges for 21 st Century Researchers

1. Schizophrenia and Other Human Psychiatric DiseasesChallenges for 21st Century Researchers Robert H Yolken, MD Director, Stanley Neurovirology Laboratory Ted and Vada Stanley Distinguished Professor of Pediatrics, Johns Hopkins School of Medicine, Baltimore Md. E Fuller Torrey, MD Medical Director, Stanley Medical Research Institute, Bethesda Md Faith Dickerson, PhD Director of Psychology, Sheppard Pratt Health System, Baltimore Md.

2. SchizophreniaClinical and Epidemiological Features • Positive Symptoms • Hallucinations, Delusions, Disordered Thinking • Negative Symptoms • Withdrawal, Amotivation, Restricted Expressiveness • Impairment in Cognitive and Social Functioning • Structural and Functional Brain Abnormalities • Lifetime prevalence approximately 1% • Peak onset of Symptoms in Young Adulthood • Massive societal Consequences Worldwide • Currently Available Medications • Symptomatic improvement • High rate of side effects • Do not affect overall disease process

3. Genetics Of Schizophrenia • Increased Incidence in BiologicalFirst Degree Relatives • General Population  1% • First Degree Relatives 7-9% • Monozygotic Twins  30% • Most individuals with schizophrenia do not have a first degree relative with this disease. • Genetic factors have a largerelative risk but a small risk in the overall population(5%) • Intensive search for genes using molecular methods • Multiple (>30) chromosomal regions of linkage • Genetic polymorphisms of minor effect (OR~2) • No genes of major effect in different populations

4. Microbial Agents and SchizophreniaEpidemiological Findings • Specific Infectious Agent • Perinatal Rubella (Brown et al, 2001; OR~3.5) • Neonatal Enterovirus (Jones et al, 1998 OR~4) • Maternal Herpesvirus (Buka 2001; OR~4) • Possible Infectious Exposure • Seasonality of Birth (Torrey at al, 1998; OR~2) • Urban Birth (Mortenson et at, 1999, OR~2.5) • Exposures in Pregnancy (Brown et al, 2000; Torrey et al, OR~3) • Case Reports • HIV • Herpes Simplex Virus • Borrelia bergdorferii

5. AgentGene Function HIV CCR5 Co-Receptor EBV XLP T-Cell Activity Hepatitis B Man BP Viral binding Mycobacteria Il12; IFN R Phagocytosis Salmonella Il12; IFN R Phagocytosis H pyloriHLA-DQ Immune Response S mansoni GMCSF Phagocytosis Ldonovani Cytokines Immune Function P falciparumHgS,G6PD Oxygenation Human Infectious DiseasesKnownGenetic Associations

6. Psychiatric DisordersAssociation with Viral Encephalitis Caroff et al, Psych Ann 31:193, 2001

7. Bacteria Streptococcus pyogenes Borrelia burgdorferi Treponema pallidum Ehrlichiae Mycoplasma pneumoniae Bartonella henselae Salmonella typhii Parasites Toxoplasma gondii Plasmodium falciparum Babesiae Taenia solium Leishmania donovani Infections and PsychosisBacteria and Parasites

8. Antecedents of Schizophrenia264 Cases/528 Controls Fever in Pregnancy Pregnancy Complications Delivery Complications Urban Birth Developmental Delay Family Cat Family Dog 1 2 3 4 Scz Research 46:17-23, 2000 Odds Ratio (95% Conf)

9. SchizophreniaWorking Hypotheses • Most cases of schizophrenia are the result of infections and other environmental insults occurring in genetically susceptible individuals before the onset of clinically apparent symptoms. • Distinct gene-environmental interactions may be operant in different populations. • The role of specific infectious agents can be defined by clinical trials of anti-microbial chemotherapy.

10. Identification of Infections in Schizophrenia Methods-Old and New • Analytic Methods • Differential Display PCR • Library screening • Microarrays • Two-dimensional electrophoresis • Enzyme immunoassays • Samples for Analysis • Brains collected by the Stanley Neuropathology Consortium • Cerebrospinal fluid and blood samples from individuals with recent onset schizophrenia • Blood samples from mothers of infants who developed schizophrenia in adult life

11. Differential Display PCRBrain from Individual with Schizophrenia (S) and Unaffected Control(U) M S U S U S U M

12. HIV Human Endogenous Retrovirus HERV-W

13. Endogenous RetrovirusesBorderland Between Viruses and Genes II • Dynamic Effects on Gene Function • Promoter control of adjacent genes- PLA2; Placental Genes • Functionality of viral proteins-Syncytin; ASCT1 Glutamate transporter • Interaction with infectious agents-Herpesviruses; Toxoplasma • Interaction with soluble mediators-Hormones; Cytokines • Role in Human Disease • Diabetes-Superantigen activation • Multiple Sclerosis- Glial cell function • Autoimmune Arthritis- T cell activity

14. Microbe Hormone Mediator Endogenous RetrovirusesActivation and Transcription DNA 5’LTR Viral Proteins 3’LTR

15. Reverse Transcriptase Activity Retrovirus Herpesvirus Human RetrovirusesActivation by Herpesviruses

16. Endogenous Retroviral PCR CSFs:Schizophrenia and Controls Scz DNA Ctr Herv-W HERVw GTTCAGGGATAGCCCCCATCTATTTGGCCAGGCATTAGCCCAAGACTTGAGTCAATTCTCATACCTGGACACTCTTGTCCTTCAG C1 ---------------------------------------------------C--------------------------------- A1 ------------------------------A---------------------------------------------------TG- A2 ------------------------------A---------------------------------------------------TG- A3 ----------------------------------C----------------C--G----------------------------G- A4 -----------A----------------------------T----------C--G---------------------------TG- A5 -----A------------------------------------------------------------------------------- A6 ------------T------------CA---TA-------------------C--G---------------------------TG-

17. Reactivity to RetrovirusesSchizophrenia and Controls

18. Collaborative Perinatal StudyStudy Design • 65,000 healthy mothers enrolled from 1957-1964 from 11 geographically diverse sites. • Mothers followed closely during pregnancy. • Neurocognitive and developmental testing during first 7 years of life. Primary outcomes cerebral palsy and mental retardation. • Serum samples obtained from mothers during pregnancy and infants at birth (cord). • Offspring identified with psychiatric diseases in 1990’s and matched to maternal and cord blood serum specimens.

19. Schizophrenia in Adult LifeInflammation During Fetal Development

20. Schizophrenia in Adult LifeInfection During Fetal Development 6.00 4.80 3.60 Odds Ratio 2.40 1.20 0.00 CMV IgG CMV IgM Rub IgG Rub IgM Toxo IgG Toxo IgM HSV1 IgG HSV2 IgG Herv W

21. National Children’s Study • Mandated by congress in 1999 • Scheduled to start in 2004 • Target enrollment of 100,000 births • Follow-up of offspring for 30 years • Specimen Collection and Storage • Unanswered questions • Target diseases • Number of sites • Consent requirements • System of medical care

22. Infection and Cognitive Functioning Individuals with Schizophrenia (N=229) Antibody Positive 80 75 Cognitive Score (RBANS Total) 70 65 60 HSV-1 Toxo CMV HSV-2 EBV HHV-6 Antibody Negative ** * **p<.00001 Infectious Agent (IgG Antibodies) *p<.009

23. Cognitive Functioning in Bipolar DisorderEffect of HSV-1 Infection

24. Cognitive FunctioningSchizophrenia and Bipolar Disorder HSV-1 Infected HSV-1 Uninfected 100 90 Score 80 70 60 Memory Total Cognitive Memory Total Cognitive Schizophrenia Bipolar Disorder

25. Acylovir-Mechanism of Action

26. Valacyclovir Clinical TrialIndividuals with Schizophrenia • Enrollment of 66 patients with stable schizophrenia on standard medication all given Valacyclovir 2 gm/day for 16 weeks • Evaluation by the positive and negative symptom score (PANSS) • Change in score correlated with viral antibody status at start of study • HSV1/2 • CMV • Other herpesviruses

27. Response to ValacyclovirHSV-1 Antibody Status HSV-1 Seropositive HSV-1 Seronegative Positive Symptoms Total Symptoms

28. Negative Scale Positive Scale 30 20 20 10 Percentage Improvement 10 0 0 -10 -10 2 4 8 12 16 2 4 8 12 16 2 Response to Valacyclovir by CMV Status P<.006 General Scale Total Score 20 20 P<.02 P<.0005 10 10 Percentage Improvement 0 0 -10 -10 4 8 12 16 2 4 8 12 16 CMV Seropositive CMV Seronegative

29. Cologne-Untreated Cologne-Recently Treated Cologne-Control Heidelberg-Recently Treated Heidelberg-Control Baltimore-Chronic Prevalence of CytomegalovirusPopulations with Schizophrenia 0 10 20 30 40 50 60 70 80 90 Prevalence (%)

30. New Therapies for SchizophreniaOngoing/Proposed Clinical Trials • Treatment Trials • Valacyclovir • Other medications for Cytomegalovirus • Azithromycin trial for Toxoplasma gondii • Antimicrobial aspects of Psychiatric Medications • Epidemiological Studies • Additional Perinatal Cohorts • Cohorts of Healthy Young Adults • Cohorts of High-Risk Adolescents • Intervention strategies for disease prevention

31. Infections and SchizophreniaConclusions • Recent onset schizophrenia is associated with: • Increased transcription of HERV-W • Increased levels of antibodies to CMV • Past infection with HSV-1 and Toxoplasma gondii are associated with cognitive impairment in individuals with stable schizophrenia. • Maternal exposure to infectious agents is associated with an increased rate of schizophrenia in the adult life of the offspring. • The administration of Valacyclovir can reduce symptoms in some individuals with stable schizophrenia.

32. Johns Hopkins University Loraine Brando Vern Caruthers Inna Ruslanova Bogdana Krivogorsky Stanley Program Michael Knable John Bartko Sheppard Pratt Hospital Faith Dickerson John Boronow Catherine Stallings Harvard University Steve Buka Ming Tsuang University of Heidelberg Silke Bachmann Johannes Schroeder Karolinska Institute Håkan Karlsson University of Cologne F Markus Leweke Microbial Agents and SchizophreniaAcknowledgements