250 likes | 426 Views
Data Visualization. Lecture 15 Information Visualization : Part 3. Visualizing Web Searches. www.kartoo.com. Visualizing sequence of bases, or nucleotides, in DNA is a particularly challenging application Bases are: GCAT. Sequence Visualization. Thanks to Netta Cohen
E N D
Data Visualization Lecture 15 Information Visualization : Part 3
Visualizing Web Searches www.kartoo.com
Visualizing sequence of bases, or nucleotides, in DNA is a particularly challenging application Bases are: GCAT Sequence Visualization Thanks to Netta Cohen for these three slides
Genome sequence is visualized by ‘walking’ in north (C), south (G), east (T) and west (A) directions, according to the base that is encountered Walk is not random, but we don’t understand all the rules Walking through the Genome
value AGCTGCGAGTCGAGTTGGCA… Walking through the Genome in 1D A,G purines Ui = T,C pyrimidines Ui i
Focus and Context • A recurring problem in Information Visualization is lack of screen real estate • Challenge has been addressed in some innovative ways • Want to achieve: • Focus: to see detail of immediate interest • Context: to see the overall picture
Bifocal Display • Probably the first suggestion was the bifocal display of Spence and Apperley • Play Spence bifocal_lens movie
Implemented as an image browser that scales different areas of image in different ways Chris North, Univ of Maryland Bifocal Display
Transforming the information space to the display space Visual transfer functions cf colour transfer functions in scivis Display Space Display Space Information space Information space Bifocal display context focus What is the Bifocal Display Doing? Normal display
Developing the Idea • Card, Robinson and McKinlay developed the idea into the ‘Perspective Wall’
The Perspective Wall 2D layout wrapped around a 3D structure • Space utilisation: • detail on centre • panel 3x size of • equivalent flat • wall fitting field of • view
Advantages: User can adjust ratio of detail to context Smooth animation helps user perceive object constancy Relationship between detail and context is consistent: objects bend around the corner Perspective Wall
In terms of transfer function, the situation is closer to the early Spence movie Perspective gives smoother transition from focus to context Display Space Information space Perspective Wall Perspective Wall context focus
Here is the same idea applied to menus Ben Bederson, University of Maryland See also: http://www.samuelwan.com/downloads/ com.samuelwan.eidt/fisheyemenu/ FisheyeMenuDemo.html FishEye Menus
Research pages at University of Maryland include a nice applet that allows you to compare different menu styles Arrow bar Scroll Bar Hierarchical FishEye Screenshots on next slide created from: http://www.cs.umd.edu/ hcil/fisheyemenu/ fisheyemenu-demo.shtml Comparison of Menu Styles
Menus hierarchical fisheye arrow scroll
Question • Why is a magnifying glass no good for focus and context?
Cone Trees • For large tree structures it is impossible to find sufficient screen space • Cone trees provide a solution • Here is a movie http://research.compaq.com/SRC/3D-animate/conetree.html
Focus and Context for Volume Visualization • Marcelo Cohen is studying whether we can apply focus + context ideas to volume visualization
Spence Attribute Explorer • Spence has also developed a tool called Attribute Explorer • Compare it with xmdvtool • Look for brushing concept • Here is the movie
RSVP • Recent Spence work addresses problem of browsing information spaces • Rapid Serial Visual Processing • To gain a quick view of what is available • Distinction between browsing and searching • Here is the movie
Browsing the Web • Spence has also turned his attention to browsing the web • On mobile devices! • Here is the movie
Acknowledgements • The movies were taken from Bob Spence’s Web Site at Imperial College