110 likes | 235 Views
Characterisation of the comABCDE pathway in S. pneumoniae. Megan Aylward. 19/06/08. Overview. Background What comABCDE regulates When it is switched on/off Possible negative feedback. Overview. Components. Characterisation of the promoter region. Difficulties in finding the information
E N D
Characterisation of the comABCDE pathway in S. pneumoniae Megan Aylward 19/06/08
Overview • Background • What comABCDE regulates • When it is switched on/off • Possible negative feedback
Characterisation of the promoter region • Difficulties in finding the information • ComX with RNA polymerase haloenzyme binds to cin-box –tacgaata • Strength information not available
Identification of promoter region • BLAST analysis against S. pneumoniae genome • Clustal alignment • Tried to find the promoter region in the genome cin-box ------------------------------TACGAATA---------------------- section CGAATAATTCTTTTCTATTTATTTGACCTTTACAAATAAAATGGTAACTGTGACTAATAA embl|U76218|U76218 AAAAGGATTTTCTACTCTTACTTTTATTATTG-GGGGAAGTTTAGGATTGTCATCATCTG
Model • Karlsson et al (2007) • Variables within their model include;
Parameters • ComCDE- Basal synthesis, maximal synthesis, ComE-P conc. required • All components are assumed to undergo natural decay • Some parameters from literature where available
Modelling in COR :there is one or several problems with units in this equation
Running COR ComD model Problem with the CVODE integrator: at t=0 and h=2.18217e-0.15, the corrector convergence test failed repeatedly or with |h|=hmin.
Future Modelling • Draft COR model for ComD has been generated • Other components need more information • Learn differential equations