Download
microfluidics for gene fabrication n.
Skip this Video
Loading SlideShow in 5 Seconds..
Microfluidics for Gene Fabrication PowerPoint Presentation
Download Presentation
Microfluidics for Gene Fabrication

Microfluidics for Gene Fabrication

33 Views Download Presentation
Download Presentation

Microfluidics for Gene Fabrication

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Microfluidics for Gene Fabrication Peter Carr & David Kong MIT Media Laboratory

  2. single genes* minimal life 102 103 104 105 106 107 genetic circuits genome rewrite Uses for DNA On-Demand base pairs

  3. Step1. >300 changes TAG stops become TAA stops leaves one codon free E. Coli MG1655 4.6 MB RecodingE.coli: rE.coli Step2. >4000 changes remove rare Arg coding free two more codons Step 3. >70,000 changes swap Leu and Ser codons orthogonal genetic codes! Current “price tag” >$3 million per genome (and we want several of these)

  4. Trends in de novo DNA synthesis Carlson, R. (2003) The Pace and Proliferation of Biological Technologies

  5. 25 nt Primers: t1 = b16 = 25 nt Construction oligos: b2  t15 = 48 nt total gene: = 390 bp 25 nt t1 t3 t5 CAGGTAATTCCATATGAACATCCGTCAGTCTGGTAAATACTACGAGTACAAAACTCTGGAGATCCTGGAAAAG CAAAGCGCTGCGTATCCCGGTTTCTGGTACCGGCAAACAGGCGCTGCC CCATTAAGGTATACTTGTAGGCAGTCAGACCATTTATGATGCTCATGTCTAGGACCTTTTCTTACCAAAGTTTCGCGACGCATAGGG CGTTTGTCCGCGACGG b2 b4 t7 t9 CGACCAAAAACAACACCATCTACCCTATTGAAGTTAAATCTACCTCTA GACGTTGTTACCGTTCGTAATTTCCAGATCGAAAAACTGTTCAAATTGCGAAATCTTCAACTTCTGTGACCTGGACTAGCGCTGGTTTTTGTTGTGGTAGA GGGATAACTTCAATTTAGATGGAGATTTCTGCAACAATGGCAAGCATT GGTCTAGCTTTTTGACAAGTTTAAGACGCTTTAGAAGTTGAAGACACT b6 b8 b10 t11 t13 t15 ATGCCACCCGCTGGTAACCGTTTACT CAAGAAATACAAAATCGTTATCGTTTATGAACTGTCTCAGGACGTTCG CCAAAGAAAAAATCAAGTTCAAGTACGGCATCAACTCCTAACTCGAGC GGCGACCATTGGCAAATGATGTTCTTTATGTTTTAGCAATAGCAAATACTTGACAGAGTCCTGCAAGCGTGGTTTCTTTTTTAGTTCAAGTT CGTAGTTGAGGATTGAGCTCGCCTG b12 b14 b16 SIRV-1: hjc gene parse CAGGTAATTCCATATGAACATCCGTCAGTCTGGTAAATACTACGAGTACAAAACTCTGGAGATCCTGGAAAAGAATGGTTTCAAAGCGCTGCGTATCCCGGTTTCTGGTACCGGCAAACAGGCGCTGCC GTCCATTAAGGTATACTTGTAGGCAGTCAGACCATTTATGATGCTCATGTTTTGAGACCTCTAGGACCTTTTCTTACCAAAGTTTCGCGACGCATAGGGCCAAAGACCATGGCCGTTTGTCCGCGACGG GGACCTGATCGCGACCAAAAACAACACCATCTACCCTATTGAAGTTAAATCTACCTCTAAAGACGTTGTTACCGTTCGTAATTTCCAGATCGAAAAACTGTTCAAATTCTGCGCGAAATCTTCAACTTCTGTGA CCTGGACTAGCGCTGGTTTTTGTTGTGGTAGATGGGATAACTTCAATTTAGATGGAGATTTCTGCAACAATGGCAAGCATTAAAGGTCTAGCTTTTTGACAAGTTTAAGACGCTTTAGAAGTTGAAGACACTCT ATGCCACCCGCTGGTAACCGTTTACTACAAGAAATACAAAATCGTTATCGTTTATGAACTGTCTCAGGACGTTCGCACCAAAGAAAAAATCAAGTTCAAGTACGGCATCAACTCCTAACTCGAGCGGAC TACGGTGGGCGACCATTGGCAAATGATGTTCTTTATGTTTTAGCAATAGCAAATACTTGACAGAGTCCTGCAAGCGTGGTTTCTTTTTTAGTTCAAGTTCATGCCGTAGTTGAGGATTGAGCTCGCCTG

  6. 50 bp 73 bp 108 bp 390 bp SIRV-1: hjc one-step PCA t1 t3 t5 t7 t9 t11 t13 t15 b2 b4 b6 b8 b10 b12 b14 b16

  7. (keep) A A A A G C C C C C T T T T T T G G G G (edit) (remove) T T T T T G G G G G A A A A A C A C C C Error Correction for DNA >109 copies in solution probability of correlated errors is low iteration (with strand re-partnering) makes more robust

  8. bind MutS remove MutS + mismatch (error-free DNA) DNA Error Correction Protocols Hybridization-selection Mismatch Binding/Removal Mismatch Cleavage Tian et al. Nature 432 (2004) Carr et al. NAR 32 (2004) Smith & Modrich PNAS 94 (1997)

  9. inkjet-printed microarrays (e.g. Agilent) maskless array synthesizer (e.g. Nimblegen) >105 oligos per microarray >5 megabases of DNA information >1000x reduction in oligonucleotide costs = = Tian & Church (2004): ~600 oligos 21 genes 15 kb construct High Density Oligonucleotide Microarraysa massive feedstock of DNA building blocks

  10. Making it Fast & Cheap: Challenges • Harnessing the full potential of oligo microarrays • minute amounts of material: amplification? • assembly: erratic behaviors of increasingly complex mixes • Minimizing expensive reagents (polymerases, error correction) • High throughput parallel sample handling • Process integration

  11. oligo microarray synthesis DNA error correction express/assay clone sequence/QC assemble DNA constructs user designs DNA larger scale assembly assemble DNA constructs DATA (MOLECULES) DATA Microfluidic Gene Synthesis:Integration Road Map

  12. Fabrication PDMS1 PDMS2 PDMS3 CYTOP, Paralyne, Parallel microfluidic gene synthesis Four parallel 500-nL reactors

  13. Parallel microfluidic gene synthesis Kong et al. Nucleic Acids Research, 2007

  14. 1 in 600 1 in 1400 1 in 10,00 Parallel microfluidic gene synthesis Sequencing results Carr et al. Nucleic Acids Research, 2004 -verified identity of each gene by sequencing -12.5% of clones were error-free in agreement with theoretical predictions Kong et al. Nucleic Acids Research, 2007

  15. oligo microarray synthesis oligo microarray synthesis DNA error correction express/assay clone sequence/QC assemble DNA constructs user designs DNA larger scale assembly assemble DNA constructs DATA (MOLECULES) DATA Microfluidic Gene Synthesis:Integration Road Map

  16. Integrated Microarray-Microfluidics -Perform synthesis without pre-assembly amplification -Enables increased utilization of high-density DNA microarrays by: -reducing pool complexity -limiting undesired oligo interactions -maintaining reagent concentrations at desired levels

  17. oligo microarray synthesis DNA error correction express/assay clone sequence/QC larger scale assembly assemble DNA constructs user designs DNA larger scale assembly assemble DNA constructs DATA (MOLECULES) DATA Microfluidic Gene Synthesis:Integration Road Map

  18. Hierarchical gene synthesis

  19. 300 nL reactors • On-chip mixing of synthesized fragments A, B, with a “rejuvenating mixture” of dNTPs, polymerase, and amplifying primers • Fragment A, B, and E sample collection (real time) Hierarchical gene synthesis E

  20. oligo microarray synthesis DNA error correction express/assay express/assay clone sequence/QC assemble DNA constructs user designs DNA larger scale assembly assemble DNA constructs DATA (MOLECULES) DATA Microfluidic Gene Synthesis:Integration Road Map

  21. 45 nL gene synthesis reactors, 12 nL protein synthesis reactors Integrated gene and protein synthesis oligos  gene  protein oligos  gene  protein oligos  gene  protein Fluorescence from GFP expressed in a PDMS microfluidic device Fluorescence from expressed synthetic EGFP

  22. Thank You Lu Chen Kelly Chang Byron Hsu Dr. Shuguang Zhang Prof. George Church Prof. Franco Cerrina Prof. Joseph Jacobson Funding: MIT Media Lab Center for Bits and Atoms (NSF)