Henrik Bengtsson & Terry Speed Dept of Statistics, UC Berkeley August 7, 2007 BioC 2007

1. Copy-number estimation using Robust Multichip Analysis-Supplementary materials for the aroma.affymetrix lab session Henrik Bengtsson & Terry Speed Dept of Statistics, UC Berkeley August 7, 2007 BioC 2007

2. Affymetrix chips

3. * * * * 5 µm 5 µm > 1 million identical 25bp sequences Generic Affymetrix chip * 1.28 cm 1.28 cm 6.5 million probes/chip Feature size: 100µm to 18µm to 11µmand now 5µm. Soon: 1µm, 0.8µm,with a huge increase in number of probes.

4. Abbreviated generic assay description • Start with target gDNA (genomic DNA) or mRNA. • Obtain labeled single-strandedtargetDNA fragments forhybridization to theprobeson the chip. • After hybridization, washing, staining and scanning we get a digital image. This is summarized across pixels to probe-level intensities before we begin. They are our raw data.

5. * * * * * * * * * * * 25 nucleotides Other DNA Other DNA Target seq. Other seq. X other PMs PM MM Affymetrix probe terminology Target DNA: ...CGTAGCCATCGGTAAGTACTCAATGATAG... ||||||||||||||||||||||||| Perfect match (PM): ATCGGTAGCCATTCATGAGTTACTA Mis-match (MM): ATCGGTAGCCATACATGAGTTACTA

6. Affymetrix SNP chips(Mapping 10K, 100K, 500K)

7. Single Nucleotide Polymorphism (SNP) Definition: A sequence variation such that two chromosomes may differ by a single nucleotide (A, T, C, or G). Allele A:A ...CGTAGCCATCGGTA/GTACTCAATGATAG... Allele B:G A person is either AA, AB, or BB at this SNP.

8. * * * * * * * * * * * * * * * * * * * AA BB AB PMA >> PMB PMA << PMB PMA ¼PMB Probes for SNPs PMA:ATCGGTAGCCATTCATGAGTTACTA Allele A:...CGTAGCCATCGGTAAGTACTCAATGATAG...Allele B:...CGTAGCCATCGGTAGGTACTCAATGATAG...PMB:ATCGGTAGCCATCCATGAGTTACTA (Also MMs, but not in the newer chips, so we will not use these!)

9. Copy-number analysis with SNP arrays

10. Copy-number estimation using Robust Multichip Analysis (CRMA)

11. * * * * * * * * * * * * * * * * * * * AA BB AB PMA >> PMB PMA << PMB PMA ¼PMB Copy-number estimation using Robust Multichip Analysis (CRMA) Cross-hybridization: Allele A: TCGGTAAGTACTC Allele B: TCGGTATGTACTC

12. TT AT PMT AA + PMA offset Copy-number estimation using Robust Multichip Analysis (CRMA)

13. PMT PMA Copy-number estimation using Robust Multichip Analysis (CRMA)

14. Copy-number estimation using Robust Multichip Analysis (CRMA) Crosstalk calibration corrects for differences in distributions too log2 PM

15. Copy-number estimation using Robust Multichip Analysis (CRMA) Crosstalk calibration corrects for differences in distributions too log2 PM

16. * * * * * * * * * * * * * * * * * * PM = PMA +PMB Copy-number estimation using Robust Multichip Analysis (CRMA) AA AB PM =PMA+PMB * BB PM =PMA +PMB

17. Copy-number estimation using Robust Multichip Analysis (CRMA) The log-additive model: log2(PMijk) = log2ij+ log2jk + ijk sample i, SNP j, probe k. Fit using robust linear models (rlm)

18. 100K Copy-number estimation using Robust Multichip Analysis (CRMA) Longer fragments ) less amplified by PCR ) weaker SNP signals 

19. 500K Copy-number estimation using Robust Multichip Analysis (CRMA) Longer fragments ) less amplified by PCR ) weaker SNP signals 

20. Copy-number estimation using Robust Multichip Analysis (CRMA) Normalize to get same fragment-length effect for all hybridizations

21. Copy-number estimation using Robust Multichip Analysis (CRMA) Normalize to get same fragment-length effect for all hybridizations

22. Copy-number estimation using Robust Multichip Analysis (CRMA)