kedem
Uploaded by
28 SLIDES
1400 VIEWS
500LIKES

Nucleic Acids

DESCRIPTION

Nucleic Acids. Examples: RNA (ribonucleic acid) single helix DNA (deoxyribonucleic acid) double helix Structure: monomers = nucleotides. DNA. RNA. Nucleotides. 3 parts nitrogen base (C-N ring) pentose sugar (5C) ribose in RNA deoxyribose in DNA phosphate (PO 4 ) group.

1 / 28

Download Presentation

Nucleic Acids

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Nucleic Acids • Examples: • RNA (ribonucleic acid) • single helix • DNA (deoxyribonucleic acid) • double helix • Structure: • monomers = nucleotides DNA RNA

  2. Nucleotides • 3 parts • nitrogen base (C-N ring) • pentose sugar (5C) • ribose in RNA • deoxyribose in DNA • phosphate(PO4)group Nitrogen baseI’m the A,T,C,G or Upart! Are nucleic acidscharged molecules?

  3. Types of nucleotides Purine = AG Pure silver! • 2 types of nucleotides • different nitrogen bases • purines • double ring N base • adenine (A) • guanine (G) • pyrimidines • single ring N base • cytosine (C) • thymine (T) • uracil (U)

  4. Nucleic polymer • Backbone • sugar to PO4 bond • phosphodiester bond • new base added to sugar of previous base • polymer grows in one direction • N bases hang off the sugar-phosphate backbone Dangling bases?Why is this important?

  5. Pairing of nucleotides • Nucleotides bond between DNA strands • H bonds • purine :: pyrimidine • A :: T • 2 H bonds • G :: C • 3 H bonds Matching bases?Why is this important?

  6. DNA molecule • Double helix • H bonds between bases join the 2 strands • A :: T • C :: G H bonds?Why is this important?

  7. Copying DNA • Replication • 2 strands of DNA helix are complementary • have one, can build other • have one, can rebuild the whole Matching halves?Why is this a good system?

  8. Interesting note… • Ratio of A-T::G-C affects stability of DNA molecule • 2 H bonds vs. 3 H bonds • biotech procedures • more G-C = need higher T° to separate strands • high T° organisms • many G-C • parasites • many A-T (don’t know why)

  9. From Gene to Protein How Genes Work

  10. The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait DNA gets all the glory, but proteins do all the work! replication

  11. Transcription fromDNA nucleic acid languagetoRNA nucleic acid language

  12. RNA • ribose sugar • N-bases • uracil instead of thymine • U : A • C : G • single stranded • lots of RNAs • mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

  13. Transcription • Making mRNA • transcribed DNA strand = template strand • untranscribed DNA strand = coding strand • same sequence as RNA • synthesis of complementary RNA strand • transcription bubble • enzyme • RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

  14. RNA polymerases • 3 RNA polymerase enzymes • RNA polymerase 1 • only transcribes rRNA genes • makes ribosomes • RNA polymerase 2 • transcribes genes into mRNA • RNA polymerase 3 • only transcribes tRNA genes • each has a specific promoter sequence it recognizes

  15. RNA polymerase Matching bases of DNA & RNA A • Match RNA bases to DNA bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U A 5' 3' G C C A T G G T A C A G C T A G T C A T C G T A C C G T

  16. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Eukaryotic genes have junk! • Eukaryotic genes are not continuous • exons = the real gene • expressed / coding DNA • introns = the junk • inbetween sequence intronscome out! eukaryotic DNA

  17. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA splicing • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • primary transcript = pre-mRNA • mRNA splicing • edit out introns • make mature mRNA transcript ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

  18. Splicing must be accurate • No room for mistakes! • a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

  19. Translation fromnucleic acid languagetoamino acid language

  20. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

  21. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets

  22. 1960 | 1968 Cracking the code Nirenberg & Khorana • Crick • determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT • Nirenberg (47) & Khorana (17) • determined mRNA–amino acid match • added fabricated mRNA to test tube of ribosomes, tRNA & amino acids • created artificial UUUUU… mRNA • found that UUU coded for phenylalanine

  23. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” Why is thewobble good? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

  24. GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA anti-codon aminoacid

  25. Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst…no nucleus! Cell membrane Cell wall

  26. Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes intronscome out! eukaryotic DNA

  27. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed

  28. Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • no RNA processing

More Related