1 / 37

Today

Today. G Protein Coupled Receptors. Animals. plasma membrane. signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK. activated receptor. system cycles. something happens. signal transduction pathway; cAMP phospholipase C

kalona
Download Presentation

Today

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Today

  2. G Protein Coupled Receptors Animals

  3. plasma membrane • signal transduction pathway, i.e.; • cAMP • phospholipase C • cGMP phosphodiesterase • MAPK activated receptor system cycles something happens

  4. signal transduction pathway; • cAMP • phospholipase C • cGMP phosphodiesterase • MAPK something else happens something happens

  5. Mammals ~ 4 Orthologs > 23 Paralogs

  6. Why Arabidopsis?Why me? Only one prototypical Ga protein.

  7. Gene Families

  8. Why Ga?Why did my collaborators care? Looking for the Auxin Receptor, • auxin is a plant hormone implicated in multiple physiological pathways.

  9. G Protein Coupled Receptors Auxin Functions gravitropism/thigmatropism, etc. perception of light general signal transduction embryogenesis development cell growth and differentiation “oncogenesis” etc.

  10. Auxin Receptor = G Protein Coupled Receptor? Maybe Reverse Genetics can supply an answer?

  11. Homologous Recombination Range • Yes... • mice, many well characterized mammalian cells, • bacteria, • yeast, (remember the bar code deletion project), • No (maybe)... • C. elegans (no), • Arabidopsis (done once, not repeated), • Drosophila (shown in principle, not repeated often), • the rest?

  12. T-DNA Ti-Plasmid Plant Cells Lab Selectable Markers Reporter Genes Genes Nature Hormone genes Opines genes Agrobacterium T-DNA Out: Ti genes, opine genes, In: DNA of choice.

  13. from ~500,000 seeds

  14. 60,000 mutants Set-UpDNA Pooling Maintain lines as pools of seed. Seeds (9) Germinate and grow seeds in liquid culture. Seedlings (225) Extract DNA, DNA (225) Super Pool DNA, Super Pools (2000) 1 2 3 4 5 6 …30 PCR Screen

  15. T-DNA Reaction: T-DNA Reaction: Product: Product: PCR Strategy

  16. T-DNA Insertion Confirmation G wt • Blot gel and hybridize with a WT probe. • Band isolate and cycle sequence PCR fragment.

  17. T-DNA Reaction: Product: Sequence T-DNA Insertion Sites Sequence using the PCR primer from the T-DNA sequence. T-DNA Unknown GTP GPA1: \\GCAATGTGTTATTAAGTTGTCT --- ATGCTCTC--- GAAAATTTTCGCCACTGGAAAT// GPA2: \\TGTCTAAGCGTCAATTTGTTTA --- GGGCTCTCTCT--- ACCTGCTCAGGAGCACCTTTAC//

  18. p = probability of insertion event f = 1-(Genome/Size of Gene) n = number of T-DNA inserts Probability of Finding an Insert in a Specific Gene p = 1-(1-f)n thousands of inserts

  19. Finding Random Insertion Mutants • Use PCR based approach to identify sequence with foreign DNA inserted into genes of interest.

  20. Knockology

  21. GTP binding sites. Effector domains. Receptor interaction domain. Gbg sub-units binding site. KO

  22. T-DNA Mutants Genetic Analysis TT Tt Tt tt T t 2x T-DNA Segregation T t F2 tagged seed line tt x TT (wt) isolate homozygous mutant Tt backcross to wildtype phenotype analysis

  23. TT TT TT Tt Tt Tt T T t t T t Tt Tt Tt tt tt tt T T T t t t 1 : 2 : 1 1 wt : 2 het 1 wt : 1 het Not Lethal Lethal Gametophyte Lethal Genetic AnalysisF2 Segregation

  24. Arabidopsis Gantlet Project http://thale.biol.wwu.edu/ Questions Name? Quest? Air-speed velocity of an unladen swallow? How do you spell Guantlet?

  25. Etiolated Plants?

  26. De-etiolated Plants?cell size vs. organ size

  27. Mitosis? cyc1At-CDB-GUS

  28. Overexpression? • Transgene: • GPA1 driven by an inducible promoter, • - dexamethason, • In “WT” plants.

  29. GPA1 function?BY-2 Cells • …over-express GPA1 in cell culture lines, • - measure G1 to G2 transitions, • - measure cell plate formations.

  30. ~ 11 Kb Probe SpeI SpeI SpeI wt gpa1 het gpa1 hom gpa2 het gpa2 hom …not drawn to scale. Genotype? Southern Analysis Genomic DNA, Cut with SpeI, Probe with 3’ GPA. ~ 5 Kb

  31. wt truncated Transcript? Northern Analysis Extract total RNA Use complementary DNA to probe for mRNA

  32. Protein? Western Analysis Proteins extracted Antibodies specific to GPA proteins facilitate probing for the presence of the protein. Antibody was raised to the N-terminus of the gene.

  33. Conclusions GPA1 operates in controlling cell proliferation, probably by modulating G1 control. May be involved in auxin signal reception?

  34. something happens KO MAPK?

  35. GPA1What Else?

  36. GPA1, What Else II?Brassinolide Plant Physiol, June 2002, Vol. 129, pp. 897-907 Since 2001

More Related