Today
Download
1 / 37

Today - PowerPoint PPT Presentation


  • 107 Views
  • Uploaded on

Today. G Protein Coupled Receptors. Animals. plasma membrane. signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK. activated receptor. system cycles. something happens. signal transduction pathway; cAMP phospholipase C

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Today' - kalona


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript


Today

plasma membrane

  • signal transduction pathway, i.e.;

    • cAMP

    • phospholipase C

    • cGMP phosphodiesterase

    • MAPK

activated receptor

system cycles

something happens


Today

something else happens

something happens


Today

Mammals

~ 4 Orthologs

> 23 Paralogs


Why arabidopsis why me
Why Arabidopsis?Why me?

Only one prototypical Ga protein.



Why g a why did my collaborators care
Why Ga?Why did my collaborators care?

Looking for the Auxin Receptor,

  • auxin is a plant hormone implicated in multiple physiological pathways.


G protein coupled receptors1
G Protein Coupled Receptors

Auxin Functions

gravitropism/thigmatropism, etc.

perception of light

general signal transduction

embryogenesis

development

cell growth and differentiation

“oncogenesis”

etc.


Auxin receptor g protein coupled receptor
Auxin Receptor = G Protein Coupled Receptor?

Maybe Reverse Genetics can supply an answer?


Homologous recombination range
Homologous Recombination Range

  • Yes...

    • mice, many well characterized mammalian cells,

    • bacteria,

    • yeast, (remember the bar code deletion project),

  • No (maybe)...

    • C. elegans (no),

    • Arabidopsis (done once, not repeated),

    • Drosophila (shown in principle, not repeated often),

    • the rest?


Today

T-DNA

Ti-Plasmid

Plant Cells

Lab

Selectable Markers

Reporter Genes

Genes

Nature

Hormone

genes

Opines

genes

Agrobacterium

T-DNA

Out: Ti genes, opine genes,

In: DNA of choice.


Today

from

~500,000

seeds


Set up dna pooling

60,000 mutants

Set-UpDNA Pooling

Maintain lines as pools of seed.

Seeds (9)

Germinate and grow seeds in liquid culture.

Seedlings (225)

Extract DNA,

DNA (225)

Super Pool DNA,

Super

Pools

(2000)

1

2

3

4

5

6

…30

PCR Screen


Pcr strategy

T-DNA

Reaction:

T-DNA

Reaction:

Product:

Product:

PCR Strategy


Today

T-DNA Insertion Confirmation

G wt

  • Blot gel and hybridize with a WT probe.

  • Band isolate and cycle sequence PCR fragment.


Sequence t dna insertion sites

T-DNA

Reaction:

Product:

Sequence T-DNA Insertion Sites

Sequence using the PCR primer from the T-DNA sequence.

T-DNA Unknown GTP

GPA1: \\GCAATGTGTTATTAAGTTGTCT --- ATGCTCTC--- GAAAATTTTCGCCACTGGAAAT//

GPA2: \\TGTCTAAGCGTCAATTTGTTTA --- GGGCTCTCTCT--- ACCTGCTCAGGAGCACCTTTAC//


Probability of finding an insert in a specific gene

p = probability of insertion event

f = 1-(Genome/Size of Gene)

n = number of T-DNA inserts

Probability of Finding an Insert in a Specific Gene

p = 1-(1-f)n

thousands of inserts


Finding random insertion mutants
Finding Random Insertion Mutants

  • Use PCR based approach to identify sequence with foreign DNA inserted into genes of interest.



Today

GTP binding sites.

Effector domains.

Receptor interaction domain.

Gbg sub-units binding site.

KO


T dna mutants genetic analysis
T-DNA Mutants Genetic Analysis

TT

Tt

Tt

tt

T

t

2x

T-DNA

Segregation

T

t

F2

tagged

seed line

tt x TT (wt)

isolate

homozygous

mutant

Tt

backcross

to wildtype

phenotype

analysis


Genetic analysis f2 segregation

TT

TT

TT

Tt

Tt

Tt

T

T

t

t

T

t

Tt

Tt

Tt

tt

tt

tt

T

T

T

t

t

t

1 : 2 : 1

1 wt : 2 het

1 wt : 1 het

Not Lethal

Lethal

Gametophyte

Lethal

Genetic AnalysisF2 Segregation


Today

Arabidopsis Gantlet Project

http://thale.biol.wwu.edu/

Questions

Name?

Quest?

Air-speed velocity of an unladen swallow?

How do you spell Guantlet?



De etiolated plants cell size vs organ size
De-etiolated Plants?cell size vs. organ size


Mitosis
Mitosis?

cyc1At-CDB-GUS


Overexpression
Overexpression?

  • Transgene:

  • GPA1 driven by an inducible promoter,

    • - dexamethason,

  • In “WT” plants.


Gpa1 function by 2 cells
GPA1 function?BY-2 Cells

  • …over-express GPA1 in cell culture lines,

    • - measure G1 to G2 transitions,

    • - measure cell plate formations.


Genotype

~ 11 Kb

Probe

SpeI

SpeI

SpeI

wt

gpa1

het

gpa1

hom

gpa2

het

gpa2

hom

…not drawn to scale.

Genotype?

Southern Analysis

Genomic DNA,

Cut with SpeI,

Probe with 3’ GPA.

~ 5 Kb


Transcript

wt

truncated

Transcript?

Northern Analysis

Extract total RNA

Use complementary DNA to probe for mRNA


Protein
Protein?

Western Analysis

Proteins extracted

Antibodies specific to GPA proteins facilitate probing for the presence of the protein.

Antibody was raised to the N-terminus of the gene.


Conclusions
Conclusions

GPA1 operates in controlling cell proliferation, probably by modulating G1 control.

May be involved in auxin signal reception?



Gpa1 what else
GPA1What Else?


Gpa1 what else ii brassinolide
GPA1, What Else II?Brassinolide

Plant Physiol, June 2002, Vol. 129, pp. 897-907

Since 2001