slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
II. GENOMICS: ANALYIS OF MULTIPLE MACROMOLECULES AT THE SAME TIME PowerPoint Presentation
Download Presentation
II. GENOMICS: ANALYIS OF MULTIPLE MACROMOLECULES AT THE SAME TIME

Loading in 2 Seconds...

play fullscreen
1 / 38

II. GENOMICS: ANALYIS OF MULTIPLE MACROMOLECULES AT THE SAME TIME - PowerPoint PPT Presentation


  • 86 Views
  • Uploaded on

II. GENOMICS: ANALYIS OF MULTIPLE MACROMOLECULES AT THE SAME TIME. Genomics. Structural. Functional. Integrative. Structural genomics. Genome libraries DNA sequencing Genome projects Polymorphisms RFLP. 1. Construction of a human genomic DNA library. Cleave with Restriction nuclease.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'II. GENOMICS: ANALYIS OF MULTIPLE MACROMOLECULES AT THE SAME TIME' - june


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide2

Genomics

Structural

Functional

Integrative

slide3

Structural genomics

  • Genome libraries
  • DNA sequencing
    • Genome projects
  • Polymorphisms
  • RFLP
slide4

1.

Construction of a human genomic DNA library

Cleave with

Restriction nuclease

Human double-stranded DNA

Millions of genomic DNA fragments

DNA fragments

inserted into plasmids

Introduction of

plasmids into

bacteria

Recombinant

DNA molecules

Genomic DNA library

slide5

2.

Constructing genome libraries

2.: ligation into plasmid vector

1.: partial digestion with restriction endonuclease

2

4

3

6

5

1

5

2

3

1

2

3

4

5

6

1

4

6

slide6

3.

Constructing genome libraries

5

2

2.: ligation into plasmid vector

3.: transforming into E. coli

4

3

1

6

5

2

3

1

4

6

slide7

4.

Genome Libraries

Genome library:collection of clones, in wich every pieces of the genome of a

particular organism can be found.

Usage: sequencing (genome projects), isolation of genes.

cDNA library: The cDNA library contains a cDNA copy of each mRNA of an organism (tissue or cell type). It represents the transcriptome.

Usage: gene structure determination, isolation of cDNSs (intronles gene).

slide8

5.

cDNA-libraries

How can we produce cDNA?

3’

cDNA

Second

strand

mRNA

AAAAAAAAA 3’

5’ GGGGG

5’

cDNS

first strand

3’

3’ CCCCC

TTTTTTTTT 5’

  • 1. RNA (mRNA) purification:we can use total RNA or mRNA extract
  • 2. Reverse transcription: by using of oligo dT primers and reverse transcriptase
  • (RNA-dependent DNA polimerase) the first strand of cDNA is synthesized
  • 3. RNase treatment
  • 4.Linker synthesis:theterminal deoxinucleotidil transferase (DNA
  • polimerase, which doesn’t require any template) adds the C linker to the 3’ end
  • 5. Second strand synthesis: oligo dG primers are added and the DNA polimerase
  • synthesizes the second strand of cDNA.
slide9
v

Dideoxynucleotide chain termination

or

Stop-nucleotide-method

or

Chain termination method

6.

DNA sequencing – Sanger method

Frederic Sanger

slide10

7.

DNA sequencing – Sanger method

(A) Initiation of strand synthesis

(B) A dideoxynucleotide

Primer

Template DNA

5’

3’

T

T

T

3’

5’

Base

5’

3’

T

T

T

3’

5’

5’

3’

T

T

T

3’

5’

(D) The resulting autoradiograph

(C) Strand synthesis terminates

when a ddNTP is added

ddA

DNA sequence

A T G C

T

T

T

ddA

GAATTGGCGCG

GAATTGGCGC

T

T

T

GAATTGGCG

ddA

GAATTGGC

GAATTGG

T

T

T

GAATTG

GAATT

ddA

GAAT

GAA

ddA

GA

G

ddA

The “A” family

slide11

DNA sequencing – Sanger method

8.

Template: 3’

CCGGTAGCAACT

5’

Primer : 5’

GG 3’

dATP dCTP + ddCTPdGTPdTTP

dATP dCTPdGTP + ddGTPdTTP

dATP + ddATPdCTPdGTPdTTP

dATP dCTPdGTPdTTP + ddTTP

GGCCATGGCCATCGTGGCCATCGTT

GGCCAGGCCATCGTTGA

GGCGGCCGGCCATC

GGCCATCGGGCCATCGTTG

n ACGT

A3’GTTGCTACC5’

10987654321

Sequence complementer to the template DNA

slide12

Automated DNA sequencing with fluorescently labeled dideoxynucleotides

9.

(A)

ddA

ddC

ddNTPs – each with a different fluorescent label

ddT

ddG

Sequencing reactions, fraction of products

ddT

Imaging system

ddA

ddA

ddG

ddC

Detector

ddC

ddG

Fluorescent bands move past the detector

(B)

CACCGCATCGAAATTAACTTCCAAAGTTAAGCTTGG

slide13

10.

The Human Genome Project

Craig Venter

Francis Collins

slide14

11.

Methods

Hierarchical method Shotgun sequencing

(HGP) (Celera)

Chromosomes

Generate and alignlarge BAC clones

Fragment and sequence entire genome

Fragment and sequence a subset of the clones

slide15

12.

Whose genome was sequenced?

>21

ethnically diverse volunteerdonors(both sexes)

(Celera)

>50 ethnically diverse volunteerdonors(both sexes)

(HGP)

2001

HGP & Celera Published a haploid human genome sequence

2 men, 3 women, 1-1 Asian, African, Hispanic 2 Caucasian

8 Men

(Unknown ethnical identity )

2003 First whole human genome sequence

2006 Sequence of Chromosome 1

2007 First 2 diploid genome: Venter & Watson

2008 AHan Chinese & a Yoruba men diploid genomes

slide16

Genome projects

13.

Human Genome Project1990 – Watson, Collins, WenterSequencing the whole Human Genome

HapMap Project2002Mapping SNPs

1000 genome project2008Sequencing the genomes of at least 1000 participant providing an overview of all genetic variations

Human Variom Project2008Mapping the genetic variations in the Human Genome

slide17

Polymorphisms/molecular markers in Human Genome

14.

Polymorphism in Biology: having multiple alleles of a gene within a population

slide18

VNTR & STR analysis

15.

  • 1. PCR amplification
  • PCR primers are complementers with those DNA sequences which flank the repeats
  • Lenght of PCR product deppend on:
    • Length of the „base sequence”
    • Copy number

VNTRs: 3 person 4 pair homologous chromosomes

A B C

slide19

16.

VNTR & STR analysis

2. Separated by Gel Electrophoresis

Sensitive technique: it can be done from single DNA copy

DNA fingerprint

slide20

SNPs

17.

A variation in the base sequence occuring at any given single position in the genome (for example C instead of T).

ACGGCTAA

It is found in more than 1% of the population.

slide21

SNPs

18.

A variation in the base sequence occuring at any given single position in the genome (for example C instead of T).

ATGGCTAA

It is found in more than 1% of the population.

slide22

19.

SNP analysis: ASA

slide23

RFLP

20.

Restriction Fragment Length Polymorphism

Polimorphic site

R1

R2

R3

Restriction site map

PCR primers

Agarose gel

electrophoresis

PCR followed

by restriction

slide24

21.

RFLP

slide25

Functional Genomics

22.

Microchip

Microarray scanner

Real-Time PCR cycler

slide26

23.

Chip (microarray) technology

Structural genomics

Functional genomics

DNS chip-ek

GENOME

TRANSCRIPTOM

- sequencing

- Mutation mapping

- SNPs

- deletion  insertion

- Methylation pattern

- Alterations in gene expression,

- Detection of splice variants

- Detection of regulatory RNAs

CYTOPLASM

DNA

NUCLEUS

transcription

Protein s

pre-mRNS

tRNA

protein

translation

PROTEOM

- expression

- Modifications

- interactions

mRNA

ribosome

slide27

24.

DNA chip

It is for measuring the expreesion pattern of a large number of genes at the same time

A chip contains 6-10000 gene specific probes

There are cDNA & oligonucleotide microarrays

slide28

25.

  • Preparing the chip:
  • - printing (in situ synthesis)

2. Collection of tissue samples

control

disease

3. RNA purification

4. Reverse transcription

(fluorescently labeling)

5. Hybridization

6. Reading

slide29

26.

Outline of a microarray analysis

1. Isolate RNA samples.

Synthesize DNA copies.

RNA population or probes

Clinical sample

4. Analyze data and

correlate with

histoclinical data

2. Hybridize labeled probe with

DNA microarray on a chip

2x4x8

8x4x2

3. Scan the chip

slide30

ChIP (Chromatin immunoprecipitation)

27.

Antibody bonds specific

transcription factor

Collect chromatin-antibody

complex

Immunoprecipitate

with antibody

Treat cells with formaldehyde

Sonicate to produce fragments

of chromatin

Reverse cross links

Purify DNA

DNA fragment containing specific

transcription factor binding site

Fragments of chromatin with

transcription factors

cross-linked to DNA

real time pcr
Real-Time-PCR

28.

  • Used to amplify and simultaneously quantify a targeted DNA molecule
  • Detection of fluoresce at each cycle during PCR reaction → Real-Time
  • No gel-based analysis at the end of the PCR reaction
  • Computer based analysis of the cycle fluorescence time course

Real-Time PCR cycler

slide33
Measuring mRNA expression level

„steps”:

RNA purification

Reverse transcription

(RNA cDNA)

Real-Time PCR

30.

RT2 PCR

  • „Terms”
  • Real-Time PCR = qPCR (quantitative)
  • RT2-PCR = qRT-PCR
  • RT-PCR = reverse transcription followed by PCR
slide34

31.

33.

Real-Time PCR – measuring expression

  • Treated – untreated samples
  • Healthy – diseased
  • (eg. Tumour and normal tissue samples)
  • More sensitive than microarray
  • Less samples at a time
  • Measuring
  • relative copy number
  • (∆Ct)
slide35

32.

DNA methylation analysis

  • 1. Treatment with Sodium-bisulfite
  • 2a MethylC-seq
  • 2b Real-Time PCR

Met

Met

Sodium-bisulfite

CpG CpG

CpG UpG

slide36

33.

DNA methylation analysis– MethylC-seq

Genomic DNA

Random fragmentation

slide37

34.

DNA methylation analysis– MethylC-seq

Non-methylated C

Methylated C

slide38

35.

DNA methylation analysis - Real-Time PCR

Genomic DNA

Bisulfite conversion

Real-Time PCR