joanne
Uploaded by
25 SLIDES
418 VIEWS
250LIKES

DNA Technology Genetic Engineering

DESCRIPTION

DNA Technology Genetic Engineering. DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: Cure disease (Cystic Fibrosis) Treat genetic disorders (Hemophilia, diabetes) Improve food crops (better tasting, longer shelf life, fungus resistance…)

1 / 25

Download Presentation

DNA Technology Genetic Engineering

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA TechnologyGenetic Engineering

  2. DNA Technology – science involved in the ability to manipulate genes/DNA • Purpose: • Cure disease (Cystic Fibrosis) • Treat genetic disorders (Hemophilia, diabetes) • Improve food crops (better tasting, longer shelf life, fungus resistance…) • Improve human life in general • Helps us ID genes for traits DNA Technology

  3. A. Selective Breeding - choosing organisms withdesired traits to produce the next generation • Breeding the winners of a horse race (Smarty Jones) • Taking the seeds from the Great Pumpkin I. How could you get a desired trait without directly manipulating the organisms’ DNA?

  4. Crossing organisms with different traits to produce a hardier product Ex. A mule is a cross of a horse and a donkey – Sturdy and surefooted Hybrid corn – tastes good and is more resistant to disease. B. Hybridization

  5. Maintaining the present genes bybreeding only within the population • Ex. Pedigree animals • Risk with dipping into the same gene pool and recessive traits showing up that may be lethal or harmful. C. Inbreeding

  6. By using known mutagens, attempt to force mutations to occur • Radiation & Chemicals • Not a sure bet nor do you know what you are going to get • Polyploidy (3N or 4N) plants have resulted from this – larger & hardier D. Inducing mutations

  7. II. Manipulating Genes by altering an organisms DNA DNA Technology Purpose • Cure Diseases • Treat Genetic Disorder • Improve Food Crop • Improve Human Life (reproduce desired traits)

  8. III. Practical Uses of DNA Technology (positive) • Pharmacutical Products • Genetically engineered vaccine • Increasing Agricultural Yields • (negative) • Allergies • GMO (genetically Modified Organisms) • Supperweeds

  9. Cloning • Growing a population of genetically identical cells from a single cell • Let’s discuss the positives and negatives of m cloning….. • Let’s do a little research first…… • Lab Bio: Read Pros and Cons of Cloning • Honors Bio: Read The Real Face of Cloning

  10. Treatment of a genetic disorder (like cystic fibrous) by correcting a defective gene that causes a deficiency of an enzyme. • Nasal spray that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary • Has not been proven to be successful in the long term DNA Technology: ex: Gene Therapy

  11. DNA Extraction – Chemical procedure (we’ll do this) • Restriction enzymes– molecular scissors that cut DNA at specific nucleotide sequences • Gel Electrophoresis– method to analyze fragments of DNA cut by restriction enzymes through a gel made of agarose (molecular sieve) • DNA Ligase – molecular glue that puts pieces of DNA together • Polymerase Chain Reaction (PCR)- molecular copy machine. Makes millions of copies of DNA/hr How do we copy a piece of DNA…..The Tools:

  12. Inject insulin of course but from what source? • Old method was to use sheep insulin. Costly and labor intensive • New method: Let bacteria with a human insulin producing gene make it for you Let’s suppose that you are a diabetic and can not make your own insulin. What are you to do?

  13. Transformation of a bacterium to produce human insulin 1. Extract the insulin producing gene from a healthy human 2. Using a restriction enzyme, cut the insulin producing gene out of a the DNA The Method:

  14. Bacterial enzymes – used to cut bacteriophage DNA (viruses that invade bacteria). • Different bacterial strains express different restriction enzymes • Restriction enzymes recognize a specific short nucleotide sequence • For example, Eco RI recognizes the sequence: • 5’ - G A A T T C - 3’ • 3’ - C T T A A G - 5’ • Pandindrones same base pairing forward and backwards What are restriction enzymes?

  15. Using this piece of DNA, cut it with Eco RI • G/AATTC • GACCGAATTCAGTTAATTCGAATTC • CTGGCTTAAGTCAATTAAGCTTAAG • GACCG/AATTCAGTTAATTCG/AATTC • CTGGCTTAA/GTCAATTAAGCTTAA/G Let’s try some cutting:

  16. GACCG AATTCAGTTAATTCG AATTC • CTGGCTTAA GTCAATTAAGCTTAA G Sticky end - tails of DNA – easily bindto other DNA strands Sticky end What results is:

  17. Sticky ends – Creates an overhang. EcoRI • Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends Blunt & Sticky ends

  18. Cloning vector is a carrier that is used to clone a gene and transfer it from one organism to another. • Many bacteria contain a cloning vector called a PLASMID. • PLASMID  is a ring of DNA found in a bacterium in addition to its main chromosome Cloning Vectors

  19. Use bacterial plasmids • Plasmids will be cut with the same restriction enzyme used to cut the desired gene 3. Cut cloning vector:

  20. 4. Ligation - Donor gene (desired gene) is then spliced or annealed into the plasmid using DNA ligase as the glue. Recombinant DNA - DNA with new piece of genetic information on it • 5. Plasmid is then returned to bacterium and reproduces with donor gene in it. Transgenic organism – organism with foreign DNA incorporated in its genome (genes) • 6. Bacterium reproduces and starts producing human insulin gene which we harvest from them.

  21. Recombinant DNA Donor Gene

  22. Sometimes PROMOTERS must also be transferred so the genes will be turned on. Genes are often turned off until the proteins they code for are needed. Expression of Cloned Genes

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer