460 likes | 734 Views
Klinikum der Johann Wolfgang Goethe Universität Frankfurt am Main. Antagomirs and angiogenesis Stefanie Dimmeler Institute for Cardiovascular Regeneration Center of Molecular Medicine. Supported by:
E N D
Klinikum der Johann Wolfgang Goethe Universität Frankfurt am Main Antagomirsandangiogenesis Stefanie Dimmeler Institute forCardiovascular Regeneration Center ofMolecularMedicine Supported by: DFG (SFB 553, FOR 501), the European Network of Excellence(EVGN) and the Transatlantic Network of Excellence (Leducq Foundation)
Non-coding DNA & RNA and microRNAs MicroRNA are encoded by introns or intergenic regions b) a) Gene 1 Gene 2 microRNA microRNA Dicer/ Drosha Length: app. 22 bp microRNA Each microRNA binds to and blocks up to hundreds of genes
Role of miRNA processing enzymes in angiogenesis Nucleus TARGET PREDICTION miRNA Gene 3´UTR target 5' ...UAAACUCUGUUGCAAGUGCAAUA... miR-92a 3' GUCCGGCCCUGUUCACGUUAU Pri-miRNA Drosha Pre-miRNA Dicer Translational repression 8mer (7mer) RISC assembly miRNA duplex Watson-Crick and G:U pairing at position 15-17 AU-rich content/ conserved binding site mRNA cleavage Target site close to poly(A) (position 989 – 996) Because miRs interfere with patterns of targets, miRs may represent an attractive therapeutic target to interfere with complex processes such as neovascularization and tissue repair.
MicroRNAs in the heart (Van Rooij et al., Circ Res 2008)
Expression profile of microRNAs in endothelial cells c-kit Hox/Gax VCAM, PIK3R2, SPRED TSP-1 Role of highly expressed microRNAs? miR-17-92 Cluster Kuehbacher et al, Circ Res 2007
Functions of the miR-17~92 cluster Mouse: Chromosome 14 qE4 Human: Chromosome 13 • The miR-17-92 clusterisinduced in myc-inducedtumors (enhancementoftumorangiogenesisbyparacrineeffects (miR-18:CFGF; miR-19: TSP1) (Dews et al, Nature Genetics) • miR-17~92 deficientmicedefect in B lymphopoiesis, lungdevelopmentandventricularseptaldefects(Ventura et al, Cell 2008) • miR-92 hasseveralinterestingpredictedtargetsinvolved in vesselremodellingandangiogenesis • miR-92 isinducedbyischemiaandisup-regulated in patientswith CAD
Expression of miR-92a by ischemia § § § Hind limb ischemia Regulation of neovascularization by miR-92a?
miR-92a regulatesangiogenesisand vesselpatterning Pre-miR-92 Cumulative sprout length per spheroid (% vs. Control) miR-92 O-methyl-miR-92 inhibitor * Angiogenicsprouting & Vesselformation Spheroid model Network formation Matrigel plug model Zebra fish (Bonauer et al, Science 2009)
Silencing of miR-92a in vivo using antagomirs 80 mg/kg i.v. (Krutzfeldt, J. et al. Nature, 2005) • Antagomirs(Krutzfeldt,et al. Nature 2005) • single-stranded RNA oligonucleotides • complementary to specific miRNAs • chemical modification for stability and cholesterol conjugation for better delivery miR-92a expression (heart) Krutzfeldt, J. et al. Nature Genetics (2006)
Antagomir-92a specifically inhibits miR-92a expression 8 mg/kg i.v. single injection 48 h p<0.05 n.s. n.s. p<0.05
Inhibition of miR-92a enhances cell invasion in matrigel plugs Antagomir-Co Antagomir-92a Dapi Lectin-FITC Dapi Lectin-FITC PBS Antagomir 92a * *
Inhibition of miR-92a stimulates recovery after hind limb ischemia Antagomir-Co C57/Bl6 mouse nuclei Lectin Hind limb ischemia # # * * * merge SMA * Antagomir-92a Day 0,2,4,7, and 9 Antagomir 92a 14 days Recoveryof Blood flowHistology nuclei Lectin PBS * Ischemic leg Antagomir 92a merge SMA Ischemic leg
v WMSI Antagomir- 92a Antagomir- Co Inhibition of miR-92a improves functional recovery after acute myocardial infarction C57/Bl6 mouse Acute myocardial infarction p<0.05 p<0.05 p<0.05 p<0.05 p<0.05 p<0.05 Day 0,2,4,7, and 9 Antagomir 92a AMI+Antag.-92a AMI+PBS AMI+ Antag.-co sham 14 days Pressure (mmHg) Pressure (mmHg) Pressure (mmHg) Pressure (mmHg) Recoveryof heartfunction Volume (µl) Volume (µl) Volume (µl) Volume (µl)
Inhibition of miR-92a reducesinfarctsizeandperfusion after acutemyocardialinfarction Remote Border Infarct # Antagomir-Co Antagomir-92a # Antagomir-92a Antagomir-Co * Lectin-FITC 44+3% reduced infarct size In antagomir-92a-treated mice
Inhibition of miR-92a improves recovery after ischemia • Antagomir-92a effectively and specifically reduces miR-92a expression • Antagomir-92a improves neovascularization of matrigel plugs and after hind limb ischemia • Antagomir-92a improves recovery after acute myocardial infarction: • Enhanced neovascularization • Reduced infarct size Is this beneficial effect due to a specific influence on endothelial cells / neovascularization? Expression and effect in other cardiac cells? Endogenous repair?
miR-92a targets relevant to neovascularization Target prediction using TargetScanS database
Targets downregulated by miR-92 pre92 control Integrin a5 mRNA expression Microarray eNOS MKK 4 Protein Expression Western blot Tubulin * * * * *
Functionofintegrina5 in vascularbiology Matrigelplug • Integrin subunit a5 (Fibronectin receptor) plays a crucical role in vascular biology: • Integrin a5 -/- mice: • Embryonic lethal vessel patterning defect • Shear - regulated (mechanotransduction) • Protects endothelial cells from apoptosis • Essential for endothelial cell migration and adhesion Hind limb ischemia (Yang / Hynes Development 1993; Mol Biol Cell 1996; Francis, ATVB; Urbich et al, ATVB 2000)
miR-92 regulates Integrin a5 by binding the 3`UTR Mutated Sequence Wild type 0.2 kb 0.4 kb 0.6 kb 0.8 kb 1 kb Seed sequence Integrin a5 3`UTR miR-92 * 3`UTR CMV Luciferase • Integrin a5 is increased by antagomir-92a treatment in vivo • Integrin a5 lacking the endogenous 3ÚTR partially rescues the anti-angiogenic activity of miR-92a • Integrin a5 siRNA reduced the proangiogenic activity of antagomir-92a hsa-miR-92a GUCCGGCCCUGUUCACGUUAU ITGA5 3`UTR ITGA5 3`UTR ITGA5 3`UTR ITGA5 3`UTR Human Mouse Rat Dog AAACUCUGUUGCAAGUGCAAUAAAUCUGACCCAGUG AAACUCUGUUGCAAGUGCAAUAAACCCCACCCACUG AAACUCUGUUGCAAGUGCAAUAAACCCCACUCACUG AAACUCUGUUGCAAGUGCAAUAAACCCGGCCCGGUG
SIRT1 EDG-1 Mkk4 Integrin av miR-92a Integrin a5 FBXW7 others eNOS
microRNA Studies A. Kühbacher / Bonauer C. Doebele H. Fox G. Carmona C. Urbich J. Burchfield M. Iwasaki M. Koyanagi M. Potente E. Chavakis A. Fischer T. Röxe M. Muhly-Reinholz • COLLABORATORS • Zeiher • M. Tjwa (Leibniz Group) • M. Mione (Milano)
microRNA Team Dr. Angelika Bonauer (Kühbacher) Support: Alfried Krupp Stiftung Leibniz Preis der DFG Deutsche Forschungsgemeinschaft (SFB553, TR-SFB23) Leducq Foundation: Transatlantik Network of Excellence Excellence Cluster ECCPS European Union: IP Heart Repair ERC Advanced Grant
Distribution of Cy3-conjugated antagomir-92 Lectin-FITC Dapi Infusion of Cy3-conjugated antagomir-92, 8 mg/kg b.w. Cy3-Antagomir 92a Merge Dapi Lectin Cy3 d1
miR-92a expressionpattern: effectof antagomirs-92a In situ hybridisation miR-92a Antagomir-92a Antagomir-Co miR-92a lectin miR-92a lectin DAPI Merge DAPI Merge U6, Lectin, DAPI miR-92a is expressed in endothelial cells, but also in cardiomyocyte/interstitial cell In situ U6 (control)
Antagomir 92a miR-92a Targets? Neovascularization & Functionalrecovery after ischemia Hindlimb ischemia Acute myocardial infarction Matrigel plug model
Antagomir-92a increasesIntegrina5 levels in vivo Hind limb ischemia, day 2 qRT-PCR Control Antagomir-92a Dapi Integrin a5 Dapi Integrin a5 # § Day 2 Day 2 miR-92a regulates Integrin a5 expression in vitro and in vivo
Involvement of Integrin a5 Antagomir-92a miR-92 Angiogenesis ? Integrin a5 Integrin a5 siRNA PBS Antagomir-92a p<0.05 p<0.05 + - - + scrambled siRNA + + - - + - + - + + - -
Antagomir-92a increasesIntegrina5 levels in vivo Hind limb ischemia, day 2 qRT-PCR Control Antagomir-92a Dapi Integrin a5 Dapi Integrin a5 # § Day 2 Day 2 miR-92a regulates Integrin a5 expression in vitro and in vivo
Involvement of Integrin a5 Network formation (matrigel assay) Antagomir-92a Pre-miR-92 * miR-92 Angiogenesis Integrin a5 Integrin a5 (lacking 3’ UTR) Plasmid: pcDNA ITGA5 pcDNA ITGA5 miR-92a: - - + + Integrin a5 contributes to antagomir-92a-mediated stimulation of angiogenesis in vitro
Expression of miR-92a cardiomyocytes non-cardiomyocytes miR-92 expression ( % control)
MiR-92 overexpression reduces in vitro angiogenesis Control pre92 Cumulative sprout length per spheroid (% vs. Control) Overexpression of pre-miR-92a mir-92 Angiogenesis In vitro vessel formation U6 miR-92 Control pre92 Matrigel network formation (% vs. Control) * sprout formation vascular network formation Pre-miR-92a: Inhibition of migration No effect on apoptosis/proliferation (48 h)
miR-92 overexpression reduces invasion of endothelial cells and reperfusion of matrigel plugs Transfection of HUVEC with Co or pre92 in vitro 500 µl Basal Membrane MatriGel s.c. injection Hemoglobin (Hb) content Perfusion 6 days H&E staining Invaded cells Matrigel plugs implanted with: HUVEC control HUVEC pre92 Lectin-FITC Dapi Lectin-FITC Dapi * *
miR-92 induces a vascularpatterningdefect in zebrafish Control Control pre92 pre92 pre92 pre92
Overexpression of miR-92 decreases a large subset of pro-angiogenic genes Predictedtargetanddirectlydownregulatedby miR-92a SecondarilydownregulatedbyIntegrina5 Nopredictedtargetand not regulatedbyIntegrina5
miR-106-363 cluster
* *
HR: heart rate, LVESP: left ventricular end systolic pressure, LVEDP: left ventricular end diastolic pressure
Importance of vascularization • Neovascularization is essential for functional recovery after ischemia • Vascularization is important for cardiac repair and regeneration (whatever cells are used) • Microvascular dysfunction after reperfusion therapy or during heart failure might be a target for therapy
Integrinα5 and Delta/Notch Signaling Have Complementary Spatiotemporal Requirements during Zebrafish Somitogenesis Dörthe Ju¨lich1, Robert Geisler2, Tu¨bingen 2000 Screen Consortium3, 4 and Scott A. Holley1, , 1Department of Molecular, Cellular, and Developmental Biology, Yale University, New Haven, Connecticut 06520 2Max Planck-Institut fu¨r Entwicklungsbiologie, Tu¨bingen, D-72076, Germany
Expression of miR-92a Mir-92 expression in bone marrow-derived cells isolated from healthy controls or patients with CAD Risk factors for coronary artery disease impair circulating and bone marrow-derived stem/progenitor cells miR-92a expression (Delta CT) N=6 (Dimmeler & Leri, Circ Res 2008) N=15
* *
Inhibition of miR-92a enhances cell invasion in matrigel plugs Antagomir-Co Antagomir-92a Dapi Lectin-FITC Dapi Lectin-FITC PBS Antagomir 92a * Vessels ( % Antagomir-Co)
miR-92a: effect on cardiac myocytes? Apoptosis of cardiac myocytes in vitro Cell death in vivo 0 % serum H2O2 Antagomir-92a - - + - + miR-92 has a minimal effect on hypertrophy (Sucharov et al, JMCC 2008) Antagomir-92a reduce apoptosis in vivo (by an indirect effect )