Proteins and Base Mutations
290 likes | 425 Views
This comprehensive overview explains the structure and function of proteins, including polypeptides and amino acids linked by peptide bonds. It highlights the significance of the R group in determining the identity of amino acids. The text covers different types of proteins: structural, hormonal, and functional, discussing their roles in the body. It also addresses mutations, their causes, and effects on protein function, including examples of phenotypes influenced by mutations. Understanding these concepts is crucial for grasping the complexities of genetics and biology.
Proteins and Base Mutations
E N D
Presentation Transcript
Polypeptides made up of amino acids • Peptides are at Least 2 amino acids bonded together via peptide bonds • Proteins ARE polypeptides, numerous amino acids **All AA’s look the same EXCEPT the “R” group. It’s a group of molecules. They determine which amino acid it is because each are different! **Peptide Bond between amino acids First Recall Proteins------
The amino acid sequence determines the protein!! • Shape-specific • Example - The sequence for a specific enzyme will be totally different from that of a hormone! Human Growth Hormone Amylase Enzyme Amino Acid Sequence - Polypeptide
Structural Proteins – forms part of cell materials • fibrous and stringy and provide support. Examples: Keratins strengthen protective coverings such as hair, quills, feathers, horns, and beaks. include keratin • Collagen, and elastin. Collagens and elastin provide support for connective tissue such as tendons and ligaments. Structural Proteins
Hormones – Body’s chemical messengers Functional Proteins
Hormones – Chemical Signals released by a cell or a gland in one part of the body that sends out messages that affect cells in other parts of the organism • Growth and development • Metabolism - how your body gets energy from the foods you eat • Sexual function • Reproduction • Mood • Enzymes – catalyze chemical reactions. • Example – Amylase is the enzyme that breaks starches in your mouth. Speeds up the rate of digestion. Functional Proteins
Remember that DNA is replicated during the S phase of Interphase in both Mitosis and Meiosis (the formation of gametes) • Mutations may or may not change the function of a protein • May change phenotype, how a gene is expressed • Example: brown hair is a phenotype, sickle cell anemia is a phenotype, dwarfism is a phenotype Mistakes Can Occur
***Errors in replication, transcription, cell division, or by external agents called mutagens (chemicals, radiation, X-rays etc.) ***Some occur randomly, some phenotypes are selected for in nature ***Although mutations can cause problems, if it weren’t for mutations we wouldn’t have new genes such as those for green eyes Mutations-------
** Newly synthesized DNA is EXACTLY the same as the parent DNA……or is it??
Enzymes proofread as bases are paired during replication and replace those wrongly paired • Other enzymes police the replication process • But………… “Fixing” Errors
May be random or spontaneous (influenced) • When genes have an error in their DNA code, they may not work properly, and are said to be "altered" or mutated. • DNA damage from environmental agents such as radiation (sunlight), nuclear radiation, some viruses, some chemicals, genetics, inflammation, infection • Mistakes that occur when a cell copies its DNA in preparation for cell division. • Can occur during meiosis (making of sper, and egg) Mutations
Enzymes • Speed up the rate of reaction • For example, amylase breaks down starches in your mouth Functional Proteins
Spontaneous Mutions Environmental agents such as nuclear radiation can damage DNA by breaking bonds between nucleotides on either side of the DNA molecule can occur
Some mutated cells will be defeated by the body's immune system • others will undergo apoptosis, or cell suicide. • occasionally a cell with mutations slips through proofreading safeguards. • When mutations accumulate, the genetic material is so scrambled that the cell no longer acts like a normal, healthy cell. • Tumors, mass of cells that have no purpose, may form Mutated Cells
Not malignant tumor (cancerous) • Does not invade nearby tissue or spread to other parts of the body the way cancer can. • But benign tumors can be serious if they press on vital structures such as blood vessels or nerves. • Some, such as colon polyps, can become cancerous Benign Tumors (non-cancerous)
Abnormal cells grow uncontrolled • Invades surrounding tissues • Usually capable of producing metastases (spread to other organs) • May recur after attempted removal • May cause death of the host unless adequately treated Cancerous Tumor
**Mutations can occur during meiosis, the making of sperm or egg by changing the nucleotide sequences within a gene and can be passed along to offspring **Example: Achonroplasia is a type of dwarfism that can come from a mutation during sperm formation **The mutation may produce a new trait (good OR bad) or it may result in a protein that does not work correctly. Mutations and Reproduction
** Point mutations, base substitution, affects a single base **Frameshift – Addition or deletion of a base – Affects entire protein **chromosomal mutations – affects whole chromosomes Types of Mutations
Affects a single base and change the codon • May or may not affect the amino acid • Sometimes if the third base of the codon changes, the amino acid may stay the same! • UCU • UCC • UCA • UCG ALL code for Ser Point Mutations
TACCAGGATTAACATGGAAGTGTAATC DNA AUGGUCCUAAUUGUACCUUCACAUUAG mRNA Met Met Val Val Leu Leu Ile Ile Val Pro Pro Ser Ser His His (STOP) (STOP) AminoAcid) Leu NORMAL SEQUENCE What if the C was substituted with an A ????? TACCAGGATTAA AATGGAAGTGTAATC DNA AUGGUCCUAAUU UUACCUUCACAUUAG mRNA
Addition or deletion of a base shifts the amino acids left or right affecting the whole protein. It won’t function properly Frameshift Mutation
Met Met Val Val Tyr Leu Leu Ile Ile Val Pro Leu Ser Ile His His (STOP) Ser or Arg…. Frame-Shift Mutations (Add or Delete a Base) TACCAGGATTAACATGGAAGTGTAATC AUGGUCCUAAUUGUACCUUCACAUUAG TACCAGGATTAA ATGGAAGTGTAATC… AUG GUC CUA AUU UACCUUCACAUUAG… Example: Deletion of the C shifts the entire protein over to the left – Framshifts change ENTIRE PROTEIN – There is NO STOP CODON!!
Sickle Cell Anemeia – red blood cells are misshaped (sickle-shaped) and cannot carry enough oxygen Base Substitution Example
Tay-Sachs - disorder of the central nervous system. • An enzyme that is responsible for breaking down certain fatty substances in brain and nerve cells is ineffective and these substances accumulate, eventually destroying brain and nerve cells, and so the entire central nervous system. • It is an inherited trait and you can be a carrier Example of Frameshift
To give you a better idea of genetic mutations that effect proteins (we haven’t gotten to wntirechromsomes yet) do a little research… • Research a trait, disease/disorder that is caused by a point mutation and one that is caused by a frameshift mutation. Without getting to technical, describe where the mutation occurs, the symptoms and the prognosis Your turn……..