halima
Uploaded by
18 SLIDES
608 VIEWS
200LIKES

Joel 2:28, 29

DESCRIPTION

Joel 2:28, 29 28 And it shall come to pass afterward, that I will pour out my spirit upon all flesh; and your sons and your daughters shall prophesy, your old men shall dream dreams, your young men shall see visions:

1 / 18

Download Presentation

Joel 2:28, 29

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Joel 2:28, 29 28And it shall come to pass afterward, that I will pour out my spirit upon all flesh; and your sons and your daughters shall prophesy, your old men shall dream dreams, your young men shall see visions: 29And also upon the servants and upon the handmaids in those days will I pour out my spirit

  2. Ribozymes Timothy G. Standish, Ph. D.

  3. History • At one time, in the not-too-distant past, only proteins were thought to have catalytic properties • Thomas Cech, working with Tetrahymena, wanted to get a specific full-length mRNA, which consistently appeared on gels as multiple fragments • After working for over a year to get rid of the protein that “must” catalyze intron excision, Cech finally came to the conclusion that it was not contaminating protein, but the RNA itself that was doing the catalysis • For their discovery of catalytic RNA, Thomas Cech and Sydney Altman received the 1989 Nobel Prize in chemistry

  4. Why So Excited? • Excitement about catalytic RNA revolved to a large degree around the perception that somehow this eliminates the quandary of both proteins and nucleic acids being required for life • Perhaps a sort of proto-life once existed composed only of self-replicating RNAs which reached a certain level of sophistication and developed the ability to code for and produce proteins • DNA presumably entered into the picture somewhere along the way • In this model, smaller jumps are needed to get from non-living to living systems and catalytic RNAs may represent ancient remnants of life’s evolutionary history

  5. A Disturbing Riddle “What makes the origin of life and of the genetic code a disturbing riddle is this: the genetic code is without any biological function unless it is translated; that is, unless it leads to the synthesis of the proteins whose structure is laid down by the code. But, as Monod points out the machinery by which the cell (at least the nonprimitive cell which is the only one we know) translates the code ‘consists of a least fifty macromolecular components *which are themselves coded in DNA*’ (Monod, 1970; 1971, 143). Thus the code cannot be translated except by using certain products of its translation. This constitutes a really baffling circle: a vicious circle, it seems for any attempt to form a model, or a theory, of the genesis of the genetic code.” Popper K., "Scientific Reduction and the Essential Incompleteness of All Science," in "Studies in the Philosophy of Biology," Vol. 259, 1974, p 259-284, p 270)

  6. The RNA World “Once RNA is synthesized, it can make new copies of itself only with a great deal of help from the scientist,” says Joyce of the Scripps Clinic, an RNA specialist. “It is an inept molecule,” he explains, “especially when compared with proteins.” Leslie E. Orgel of the Salk Institute for Biological Studies, who has probably done more research exploring the RNA-world scenario than any other scientist, concurs with Joyce. Experiments simulating the early stages of the RNA world are too complicated to represent plausible scenarios for the origin of life, Orgel says. “You have to get an awful lot of things right and nothing wrong,” he adds. Horgan J. 1991. "In The Beginning...," Scientific American, February, p 103. Ellipses in original

  7. Several Classes Of RNA Show Catalytic Activity • Type I introns • Type II introns • E. coli RNAase P • Viroid and virusoid hammerhead ribozymes • Possibly some parts of ribozymes • Most, if not all ribozymes are associated with proteins in vivo and these may speed up and play other roles in the reaction • By themselves ribozymes are typically much slower than protein enzymes • Most require divalent cat ions to function

  8. The Hammerhead Ribozyme Nucleotides shown in yellow are essential for efficient cleavage. Cleavage site Stem III N N H = A, C or T C G A U A A H G N N N N N G N C N’ N’ N’ N’ C N’ C N’ G A U Stem I G G N Stem II A

  9. The Hammerhead Ribozyme Nucleotides shown in yellow and orange are essential for efficient cleavage. Cleavage site Stem III N N H = A, C or T C G A U A A H G N N N N N G N C N’ N’ N’ N’ C N’ C N’ G A U Stem I G G N Stem II A

  10. The Hammerhead Ribozyme Stem III N N C G A U A A H G N N N N N G N C N’ N’ N’ N’ C N’ C N’ G A U Stem I G G N Stem II A

  11. The Hammerhead Ribozyme N’ N’ N’ N’ N N N N A U C G N N N G N C G C N’ C N’ G A A U A H G G Stem I N A Stem III Stem III

  12. The Hammerhead Ribozyme C C N N’ G C Stem II N N N’ G A C G A G Mg++ G U C N’ N’ N’ N’ A N N N N A H A U Stem I Stem III C G N N

  13. The Hammerhead Ribozyme N N’ G C N N N’ G A C G A G G U C N’ N’ N’ N’ A N N N N A H A U C G N N Stem II Mg++ Stem I Stem III

  14. The Hammerhead Ribozyme N N’ G C N N’ G N’ N’ N C G A N N’ A N G N’ N G U C A N H A A U C G N N Cleavage site Stem II Mg++ Stem I Stem III

  15. 3D Structure

  16. The RNA Editing:A Heresy of Molecular Biology? • The central dogma of molecular genetics says that DNA is transcribed to make RNA which is translated to make proteins • Implicit in this dogma is the assumption that information flows in one direction, from DNA to RNA and then proteins, thus all information must originate directly in the sequence of bases in DNA • RNA editing provides a startling exception to this system • RNA editing involves modification, addition or deletion of bases resulting in changes in codon meaning

  17. Trypanosoma bruci Cytochrome C Oxidase III 5’__ACG_GG___A___GA_____G_G____A__ACG__G_A_CCAG_A__G______A_GG_____A_G_AGTTGAG___G____A___A_GGCG______GTTTTG_A__A___GG___A_G___A_____G_G__G_GAG___GCTTTCG______G___ACC__A_A_G____G__G___A__A_G_GA__A_GG____G______A__GGTTA______AGA___A___AA___G__GA_AAA_ACA____ATTTGT__G__AG_GG___A___G__AA_______G____G_GTTTTTGG___AGG_______G__GTTTTG__G____G_A__A_GA__GAG___G__G___GTTTTG______G_____G_GAAACCAG__ATGAGAGTTTTTGCA__G__A___A__ACA__AAG__G_GGTGTTTT3’ ACGT = DNA sequence ACGU = mRNA coded in DNA U = Bases inserted into mRNA T = Bases removed from mRNA 5’ACGGGAGAGGAACGGACCAGAGAGGAGAGTTGAGGAAGGCGGTTTTGAAGGAGAGGGGAGGCTTTCGGACCAAGGGAAGGAAGGGAGGTTAAGAAAAGGAAAAACAATTTGTGAGGGAGAAGGGTTTTTGGAGGGGTTTTGGGAAGAGAGGGGTTTTGGGGAAACCAGATGAGAGTTTTTGCAGAAACAAAGGGGTGTTTT3’ 5’UUACGUGGUUUAUUUGAUUUUUGUGUUUUAUUACGUUGUAUCCAGUAUUGUUUUUUAUGGUUUUUAUGUAGU=GAGUUUGUUUUAUUUAUGGCGUUUUUUGUU==GUAUUAUUUGGUUUAUGUUUAUUUUUGUGUUGUGAGUUUGCUUUCGUUUUUUGUUUACCUUAUAUGUUUUGUUGUUUAUUAUGUGAUUAUGGUUUUGUUUUUUAUUGGU=AUUUUUUAGAUUUAUUUAAUUUGUUGAUAAAUACAUUUUAUUUGUUUGUUAGUGGUUUAUUUGUUAAUUUUUUUGUUUUGUGUUUUUGGUUUAGGUUUUUUUGUUGUU==GUUGUUUUGUAUUAUGAUUGAGUUUGUUGUUUG====GUUUUUUGUUUUUGUGAAACCAGUUAUGAGAGUUU==GCAUUGUUAUUUAUUACAUUAAGUUGUGGUGUU==3’

  18. The End

More Related