gyda
Uploaded by
44 SLIDES
882 VIEWS
490LIKES

Molecular Phylogenetics

DESCRIPTION

Molecular Phylogenetics. Dan Graur. Objectives of phylogenetics. Reconstruct the correct genealogical ties among biological entities Estimate the time of divergence between biological entities Chronicle the sequence of events along evolutionary lineages. Molecular phylogenetics.

1 / 44

Download Presentation

Molecular Phylogenetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Molecular Phylogenetics Dan Graur

  2. Objectives of phylogenetics • Reconstruct the correct genealogical ties among biological entities • Estimate the time of divergence between biological entities • Chronicle the sequence of events along evolutionary lineages

  3. Molecular phylogenetics Molecular phylogenetics = The study of evolutionary relationships among biological entities (individuals, populations, species, or higher taxa), by using a combination of molecular data (such as DNA and protein sequences, presence or absence of transposable elements, and gene-order data) and statistical techniques.

  4. Some history… ?

  5. Charles Darwin to Thomas Huxley (1857) “The time will come I believe, though I shall not live to see it, when we shall have fairly true genealogical [phylogenetic] trees of each great kingdom of nature.”

  6. The Tree of Life Web Project tolweb.org

  7. The first study to employ molecular data in phylogenetics preciptin test George Henry Falkiner Nuttall 1862-1937 Blood Immunity and Blood Relationship (1904)

  8. preciptin test “If we accept the degree of blood reaction as an index of the degree of blood-relationship within the Anthropoidea, then we find that the Old World apes are more closely allied to man than are the New World apes, and this is exactly in accordance with the opinion expressed by Darwin.”

  9. Nomenclature, Systematics,Phylogenetics, Taxonomy, & Classification • Nomenclature = the naming of organisms • Classification = the assignment of taxa to groups of organisms • Taxonomy = Nomenclature + Classification • Phylogenetics = Evolutionary patterns & relationships among organisms • Systematics = Taxonomy + Phylogenetics

  10. What is a“species”?

  11. “Species” Concepts • There are many difficulties associated with the definition of “species.” • Definitions that work well for some groups of organisms do not necessarily work for other organisms (extant versus fossil species). • Some species concepts take evolution into account and attempt to address problems that are associated with a species being an evolving rather than an immutable biological entity.

  12. 1. The Typological “Species” Concept • Species are discrete, stable, and unchanging. • The concept dates back to Aristotle, adopted by Linnaeus. • The description of the species is based on a holotype. A holotype is a single specimen of the organism on which the formal description of the species is based. Additional specimens used in the description are referred to as paratypes. • Individuals are assigned to a species if they have the characteristic morphology of the holotype.

  13. Collection site: Cabramatta, New South Wales, Australia, on trunk of dead Acacia fulcata. Date: 11/10/1959 Collector: C. E. Chadwick Jaczyk F. 1966. Ein neue Laemosaccus aus New-Südwales (Australien). Annalen des Naturhistorischen Museums in Wien 63: 213-214. Laemosaccus chadwicki Jaczyk

  14. 2. The Phenetic or Numerical Taxonomy “Species” Concept • A species is defined as a set of organisms that resemble one another and are distinct from other sets (there is no ideal holotype, but only a statistical agglomerate). • A modern outgrowth of the typological concept. • Numerical measurements of as many characters as possible are used to define clusters of organisms (ad hoc species).

  15. 4 legs black

  16. 3. The Biological “Species” Concept • The biological species concept was proposed by Theodosius Dobzhansky in the 1930s. It has been elaborated on and reworked by Verne Grant, Julian Huxley and Ernst Mayr. Mayr’s definition: “Species are groups of interbreeding natural populations that are reproductively isolated from other such groups.”

  17. 3. The good things about the Biological “Species” Concept • Species are cohesive gene pools that are held together by gene flow. Organisms in a species are defined by the exchange of genes, or at least by the potential to exchange genes. Gene flow is the “glue” that holds a species together. • Biological species are reproductively isolated from each other. Reproductive isolation severes the ties that bind populations together and allows populations to diverge from each other.

  18. 4. The bad things about the Biological “Species” Concept • The concept applies only to sexually reproducing species and has no application to asexual organisms. • The concept cannot be applied to fossils or museum specimens. • Overlapping ranges and partial interbreeding render the biological species concept difficult to apply.

  19. 4. The Evolutionary/Phylogenetic “Species” Concept (the theory) • Promoted mainly by George Gaylord Simpson • An evolutionary species is a lineage (ancestor-descendant populations), evolving separately from other lineages.

  20. The good things about the Phylogenetic “Species” Concept • This species definition derives from an evolutionary perspective of ancestry and descent. The bad things about the Phylogenetic “Species” Concept • It is inapplicable to species that do not abide by the tree metaphor (e.g., bacteria, wheat).

  21. Is there a perfect "species” concept?

  22. 5. The Intuitive “Species” Concept Bored with her husband and her polo-playing lover, will the middle-aged heroine go away with the young man who gave her a lift when her car broke down? Can the state of Ohio, consistent with the First Amendment, ban the showing of the film The Lovers (Les Amants) which has been deemed obscene?

  23. 5. The Intuitive “Species” Concept “Hard-core pornography — I shall not today attempt to define the kinds of material I understand to be embraced within that shorthand description, and perhaps I could never succeed in intelligibly doing so. But I know it when I see it.” Justice Potter Stewart (1964) in Jacobellis vs. Ohio

  24. 5. The Intuitive “Species” Concept “Nor shall I here discuss the various definitions which have been given of the term species. No one definition has as yet satisfied all naturalists; yet every naturalist knows vaguely what he means when he speaks of a species.” Charles Darwin. 1859. The Origin of Species.

  25. 5. The Intuitive “Species” Concept “I look at the term species as one arbitrarily given, for the sake of convenience, to a group of organisms resembling each other.” Charles Darwin. 1859. The Origin of Species by Means of Natural Selection.

  26. How do species originate?

  27. Wood frog Rana sylvatica Northern leopard frog Rana pipiens

  28. Reproductive isolation by negative epistasis Dobzhansky-Muller-[Bateson] model for the origin of reproductive isolation

  29. Reproductive isolation by negative epistasis The loci Lethal hybrid rescue (Lhr) and Hybrid male rescue (Hmr) in Drosophila simulans and Drosophila melanogaster interact with each other in a manner predicted by the Dobzhansky-Muller. Brideau NJ, Flores HA, Wang J, Maheshwari S, Wang X, Barbash DA. 2006. Two Dobzhansky-Muller genes interact to cause hybrid lethality in Drosophila. Science 314:1292-1295.

  30. What kind of data? Molecular (DNA, RNA, proteins) atcgatcgtgatcgatcgtagcatcgatgcatcgtacg MWRCPYCGKRQWCMWG Morphological (soft tissue, hard tissue, extant, extinct)

  31. Advantages of Molecular Data: 1. Molecular entities are strictlyheritable.

  32. Advantages of Molecular Data: 2. The description of molecular characters is unambiguous. A TTAC is a TTAC is a TTAC is a TTAC.” Sorry, Gertrud

  33. Advantages of Molecular Data: 2. The description of molecular characters is unambiguous. The third amino acid in the preproinsulin of the rabbit (Oryctolagus cuniculus) is always serine, and the homologous position in the preproinsulin of the golden hamster (Mesocricetus auratus) is always leucine. Morphological descriptions frequently contain such ambiguous modifiers as "thin," "reduced," "slightly elongated," "partially enclosed," and "somewhat flattened."

  34. Advantages of Molecular Data: 3. There is some regularity to the evolution of molecular traits.

  35. Advantages of Molecular Data: 4. Molecular data are amenable toquantitativetreatment.

  36. Advantages of Molecular Data: 5. Homology assessment is easier than with morphological traits.

  37. Advantages of Molecular Data: 6. Molecular data are robust to evolutionary distance.

  38. Advantages of Molecular Data: 7. Molecular data are abundant.

  39. Example: Microbial morphologies are very simple, i.e., they provide only very few characters for comparative studies. In contrast, molecular variation is abundant.

  40. Proconsul Black: Parts found in situ by Tom Withworth in 1951. Blue: Parts found in museum drawers by Alan Walker & Martin Pickford during the restoration in 1985.

More Related