gunda
Uploaded by
32 SLIDES
630 VIEWS
350LIKES

The Genetic Code

DESCRIPTION

The Genetic Code. chapter 15. 姓名:雷曹琦 学号: 200431060138. Summery of the chapter. Introduction Characters of the genetic code Three Kinds of Point Mutations Alter the Genetic Code SUPPRESSOR MUTATIONS CAN RESIDE IN THE SAME OR A DIFFEREN. Introduction.

1 / 32

Download Presentation

The Genetic Code

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. The Genetic Code chapter 15 姓名:雷曹琦 学号:200431060138

  2. Summery of the chapter • Introduction • Characters of the genetic code • Three Kinds of Point Mutations Alter the Genetic Code • SUPPRESSOR MUTATIONS CAN RESIDE IN THE SAME OR A DIFFEREN...

  3. Introduction • The translation of genetic information into amino acid sequences • The discovery of the genetic code

  4. As the testified by the genetic experiment, the proportion of one amino acid to three consecutive nucleotides is correct, so every triplet codons are responsible for a special amino acid.

  5. NORMAL:ACGACGACGACGACGACGACGACGACGACGACG • ThrThrThrThrThrThrThrThrThrThrThr • ABNORMALY:ACGCGACGACGACGACGACGACGACGACGACGA • ThrArgArgArgArgArgArgArgArgArgArg • ADD ANOTHER ONE :ACGCGACGCACGACGACGACGACGACGACGACG • ThrArgArgThrThrThrThrThrThrThrThr • ThrThrThrThrThrThrThrThr

  6. Genetic Proof that the Code Is Read in Units of Three • The gene could tolerate three insertions but not one or two, the genetic code must be read in units of three.

  7. In 1964, Nirenberg found that every three artificial nucleotides had the function to be the template as the m-RNA.

  8. The Genetic code The degeneracy of the genetic code 返回

  9. Characters of the genetic code • The code is degenerate • The code is nearly universal • The codes are nonoverlapping and contains no gaps • The codes have polarity

  10. The degeneracy of the Code ★many amino acids are specified by more than one codon ★ codons specifying the same amino acid are synonyms ★the degeneracy always happens on the third nucleotide ★only Met and Trp have one codon

  11. The degeneracy of the genetic code greatly decreases the opportunities of the mutant.

  12. Perceiving Order in the Makeup of the Code Critical stem and loop regions of the tRNA structure are labeled. The red hexagons linked to the G denote methylation at the N1 position of the base. Note that the codon is shown in a 3' to 5' orientation

  13. Perceiving Order in the Makeup of the Code • Mutations in the first position of a codon will often give a similar amino acid. CUU→AUU ↑ ↑ Lue Ile

  14. Perceiving Order in the Makeup of the Code • Whenever the first two positions of codon are both occupied by G or C (A or T), each of the four nucleotides in the third position specifies the same amino acid. UAU→UAC GCU→GCC ↑ ↑ Tyr Ala

  15. Wobble in the Anticodon • A specific tRNA anticodon exist for every codon. • That highly purified tRNA species of known sequence could recognize several different codons. • In 1966, Francis Crick devised the wobble concept. The advance of wobble concept

  16. Wobble in the Anticodon It states that the base at the 5' end of the anticodon is not as spatially confined as the other two, allowing it to form hydrogen bonds with any of several bases located at the 3' end of a codon.

  17. Pairing Combinations with the Wobble Concept Base in Anticodon Base in codon G C A U I U or C G U A or G A ,U

  18. the three anticodon bases---as well as the two following(3') bases in the anticodon loop---all point in roughly the same direction, with their exact conformations largely determined by stacking interactions between the flat surfaces of the bases.

  19. Pairing Combinations with the Wobble Concept • the first(5') anticodon base is less restricted,wobble take place in the third(3') position of the codon. • not only does the third (3') anticodon base appear in the middle of the stack, but the adjacent base is always a bulky modified purine residue.

  20. Thus, restriction of its movements may explain why wobble is not seen in the first(5') position of the code.

  21. The code is nearly universal The code is nearly universal in the translation system , but it has some differences in the protein synthesis system of mitochondrial codes.

  22. Codon(5'→3') standard mitochondrial • AUA IleMet • AUG Met Met • UGA Term.Trp • UGG Trp Trp • AGA ArgTerm. • AGG Arg Term.

  23. The codes are nonoverlapping and contains no gaps The successive codons are represented by adjacent trinucleotides in register. The successive codons without commas.

  24. The codes have polarity The codes are read in 5, to 3, direction 返回

  25. Three Kinds of Point Mutations Alter the Genetic Code • Missense mutation: An alteration that changes a codon specific for one amino acid to a codon specific for another amino acid . The classic example:human genetic disease sickle cell anemia. Glu 6 (in the globin subunit) →val

  26. Three Kinds of Point Mutations Alter the Genetic Code 2.Nonsense mutation: an alteration causing a change to a chain-termination codon. 3.Frameshift mutation:insertions or deletions of one or a small number of base pairs that alter the reading frame. 返回

  27. SUPPRESSOR MUTATIONS CAN RESIDE IN THE SAME OR A DIFFERENT GENE The effects of harmful mutations can be reversed by a second genetic change. • Suppresser mutation occurring within the same gene as the original mutation. • Suppresser mutation occurring at a different site in this gene and those occurring in another gene

  28. Missense mutation’s effect can sometimes be reversed through an additional missense mutation in the same gen.

  29. Intergenic Suppression Involves Mutant tRNAs • Suppressor genes do not act by changing the nucleotide sequence of a mutant gene. Instead, they change the way the mRNA template is read. • One of the best known examples of suppressor mutations are mutant tRNA genes that suppress the effects of nonsense mutations in proteinxoding genes.

  30. Nonsense Suppressors also Read Normal Termination Signals • In the presence of the suppressor tRNA , the chain-terminating signals are read as special Aa codons. • Suppressor tRNA would be expected to result in the production of many more aberrantly long polypetides.

More Related