1.01k likes | 1.12k Views
Explore the fascinating process of protein synthesis within a cell through interactive exercises. Understand DNA, transcription, and translation in a fun and educational way. Click now to embark on this exciting journey!
E N D
Protein Synthesis Lab Click Here to Begin Your Lab
Background • Welcome to the CELL. Many process occur regularly that keep the CELL alive. Of these processes, one of the most important is a process called “Protein Synthesis.” It is this process that uses the information stored in DNA to create the CELL’S proteins. Click here to continue
Warm-up Directions: On your sheet of paper, match each definition to the correct term • DNA • mRNA • codon • tRNA • Ribosome • Brings the amino acids to the ribosome • Assembles the protein by combining amino acids • Stores the information on how to make the various proteins of the body. • Is a copy of a gene that can leave the nucleus later to be read by a ribosome. • Equals 3 bases, also equals 1 amino acid Click here to continue
The first step of Protein synthesis is called Transcription. Click on the organelle where transcription takes place in eukaryotic cells Mitochondria Mitochondria Rough E.R. Golgi Apparatus Smooth E.R. Nucleus Ribosomes
Step 1: Transcription • Transcription is the first step of protein synthesis. This step takes place in the nucleus of eukaryotic cells. Segments of DNA called genes store the information on the proper order of amino acids to construct the cells proteins. Click on one of the chromosomes to see what genes they contain. Once you have finished with all 3 chromosomes, click here to answer the final lab questions. Chromosome 2 Chromosome 3 Chromosome 1
Chromosome 1 • DNA is too valuable to allow it to leave the nucleus, so the cell copies it into the form of mRNA. Messenger RNA can then take this information out of the nucleus to the ribosomes to make the proteins. • Directions: You need to transcribe the DNA message below into the form of mRNA on your paper. Also write down what Chromosome you are working on. (Click here to review Base Pairing Rules) GCGCGCGTACAGGAAAGCCACAAGTTGTGATAGCGGGCGCATATTATCCTGCATCCGGTTTC Once you are done with transcription Click here to move to translation
Chromosome 2 • DNA is too valuable to allow it to leave the nucleus, so the cell copies it into the form of mRNA. Messenger RNA can then take this information out of the nucleus to the ribosomes to make the proteins. • Directions: You need to transcribe the DNA message below into the form of mRNA on your paper. Also write down what Chromosome you are working on. (Click here to review Base Pairing Rules) CCGGAATCTACTAGTATTTCTAGGGTCTTACGAAACTCCGTCCCGTCATTCGTGCTATCCGA Once you are done with transcription Click here to move to translation
Chromosome 3 • DNA is too valuable to allow it to leave the nucleus, so the cell copies it into the form of mRNA. Messenger RNA can then take this information out of the nucleus to the ribosomes to make the proteins. • Directions: You need to transcribe the DNA message below into the form of mRNA on your paper. Also write down what Chromosome you are working on.(Click here to review Base Pairing Rules) CTGCGCAACCTACCCTAAACTCGACTTTCATAGGAAAGACTTTCACATCGCCAGCATCC Once you are done with transcription Click here to move to translation
Step 2: Translation • Translation is the second step in protein synthesis. Here, the mRNA is read by the ribosome by matching up codons to amino acids. • Directions: Use your mRNA and click on the codons to see what the amino acids are. Write down the amino acids on your paper. Click here to begin Translation
Messenger RNA now leaves the nucleus. To begin translation click on the organelle that reads the mRNA and makes the protein. Mitochondria Mitochondria Rough E.R. Golgi Apparatus Smooth E.R. Nucleus Ribosomes
Directions: Below are mRNA codons. Using your transcribed gene from the first part of the lab, click on the various codons to see what the amino acids are for each. Write the amino acids down in the proper order until you come to the stop codon. The amino acids in this lab are represented by words and linked together to make sentences (proteins). (Note: some codons may be used more than once). Once you have finished putting your protein together, click here. GUC UGG CUC AAA CAU CGA UAC UAU UGU GCA GCG UGA GAA CGU CGC UCG ACU AUU UCC GCU AAU UCU UAG ACA GUG GAG AGG UUU CGG GCC CUA AAG AGU GUU ACC AGA CCG CCA GAU UCA AUG AUC CCC GGA CUG GUA UUA AGC UUC ACG GAC GGU CCU AUA CAG CAA AAC UUG CAC GGG GGC UGC CUU UAA
STOP CODON THIS IS THE END OF YOUR PROTEIN (SENTENCE)
STOP This is NOT a stop codon. This is a word in the sentence.