70 likes | 176 Views
DNA Fingerprinting. Enzymes. Enzymes are proteins that are used for a specific job in a cell. The enzymes used to make a DNA Fingerprint cut DNA bases in a specific spot.
E N D
Enzymes • Enzymes are proteins that are used for a specific job in a cell. • The enzymes used to make a DNA Fingerprint cut DNA bases in a specific spot. • The DNA is then run through a magnetic set-up called gel electrophoresis which separates and graphs the DNA by how long the segments are.
For the crime: • We will use the enzymes EcoR1 and HindIII • One of you choose EcoR1 and one choose HindIII…write the choice at the top of your paper • EcoR1: will break the DNA between the bases G/AATTC • Hind III: Will break the DNA between the bases A/AGCTT
Now that you have made the breaks, count the # of bases between each one. • For example: • TTACGTAGAATTCCCGAATTCATCGG
We will graph each of the pieces of Dna: • A line represents each segment of DNA
Next you need to combine the breaks of EcoR1 and HindIII to break the DNA into smaller yet fragments. • On the new paper, recopy your breaks from EcoR1… • Pass to your partner for HindIII • This will make smaller fragments.
Graph the combined breaks on the appropriate graph. • Whichever suspects matches these breaks is the criminal. • Criminal investigators will get the picture (similar to the graphs you just made) to determine who committed the crime.