garnet
Uploaded by
28 SLIDES
424 VIEWS
280LIKES

Lab #7

DESCRIPTION

Lab #7. DNA Fingerprinting & DNA Model Construction. A. G. Instructions: pp. 81-86, Bio 3 lab Manual. T. C. A eukaryotic cell has many more genes than a prokaryotic cell. Whereas a typical bacterium might have 3,000 genes, human cells have approximately 25,000 genes.

1 / 28

Download Presentation

Lab #7

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Lab #7 DNA Fingerprinting & DNA Model Construction

  2. A G Instructions: pp. 81-86, Bio 3 lab Manual T C

  3. A eukaryotic cell has many more genes than a prokaryotic cell. Whereas a typical bacterium might have 3,000 genes, human cells have approximately 25,000 genes. • Each chromosome contains a few thousand genes, Smallest chromosome Y = ~59 million base pairs (bp) • Largest chromosome # 1 = ~263 million bp

  4. Chromosomes • 22 pairs (autosomes) + XY (sex chromosome) = 46 • One of each pair donated from each parent’s egg or sperm • sex chromosomes: X,Y for males; X,X for females • Each chromosome contains a few thousand genes, • smallest chromosome Y = ~59 million base pairs (bp) • largest chromosome #1 = ~263 million base pairs (bp)

  5. LDL Receptor gene sequence (partial) ttccattgttggcagagacagatggtcagt 1 ttccattgttggcagagacagatggtcagtctggaggatg acgtggcgtg aacatctgcc 61 tggagtcccg cccctgccca gaacccttcc tgagacctcg ccggccttgt tttattcaaa 121 gacagagaag accaaagcat tgcctgccag agctttgttt tatatattta ttcatctggg 181 aggcagaaca ggcttcggac agtgcccatg caatggcttg ggttgggatt ttggtttctt 241 cctttcctgt gaaggataag agaaacaggc ccggggggac caggatgaca cctccatttc 301 tctccaggaa gttttgagtt tctctccacc gtgacacaat cctcaaacat ggaagatgaa 361 agggcagggg atgtcaggcc cagagaagca agtggctttc aacacacaac agcagatggc 421 accaacggga ccccctggcc ctgcctcatc caccaatctc taagccaaac ccctaaactc 481 aggagtcaac gtgtttacct cttctatgca agccttgcta gacagccagg ttagcctttg 541 ccctgtcacc cccgaatcat gacccaccca gtgtctttcg aggtgggttt gtaccttcct 601 taagccagga aagggattca tggcgtcgga aatgatctgg ctgaatccgt ggtggcaccg 661 agaccaaact cattcaccaa atgatgccac ttcccagagg cagagcctga gtcaccggtc 721 acccttaata tttattaagt gcctgagaca cccggttacc ttggccgtga ggacacgtgg 781 cctgcaccca ggtgtggctg tcaggacacc agcctggtgc ccatcctccc gacccctacc 841 cacttccatt cccgtggtct ccttgcactt tctcagttca gagttgtaca ctgtgtacat 901 ttggcatttg tgttattatt ttgcactgtt ttctgtcgtg tgtgttggga tgggatccca 961 ggccagggaa agcccgtgtc aatgaatgcc ggggacagag aggggcaggt tgaccgggac 1021 ttcaaagccg tgatcgtgaa tatcgagaac tgccattgtc gtctttatgt ccgcccacct 1081 agtgcttcca cttctatgca aatgcctcca agccattcac ttccccaatc ttgtcgttga 1141 tgggtatgtg tttaaaacat gcacggtgag gccgggcgca gtggcctcac gcctgtaatc

  6. LDL Receptor gene sequence (partial) ttccattgttggcagagacagatggtcagt Peter Paul atccattgttggcagagacagatggtcagt 1 accatttgttggcagagacagatggtcagtctggaggatg acgtggcgtg aacatctgcc 61 tggagtcccg cccctgccca gaacccttcc tgagacctcg ccggccttgt tttattcaaa 121 gacagagaag accaaagcat tgcctgccag agctttgttt tatatattta ttcatctggg 181 aggcagaaca ggcttcggac agtgcccatg caatggcttg ggttgggatt ttggtttctt 241 cctttcctgt gaaggataag agaaacaggc ccggggggac caggatgaca cctccatttc 301 tctccaggaa gttttgagtt tctctccacc gtgacacaat cctcaaacat ggaagatgaa 361 agggcagggg atgtcaggcc cagagaagca agtggctttc aacacacaac agcagatggc 421 accaacggga ccccctggcc ctgcctcatc caccaatctc taagccaaac ccctaaactc 481 aggagtcaac gtgtttacct cttctatgca agccttgcta gacagccagg ttagcctttg 541 ccctgtcacc cccgaatcat gacccaccca gtgtctttcg aggtgggttt gtaccttcct 601 taagccagga aagggattca tggcgtcgga aatgatctgg ctgaatccgt ggtggcaccg 661 agaccaaact cattcaccaa atgatgccac ttcccagagg cagagcctga gtcaccggtc 721 acccttaata tttattaagt gcctgagaca cccggttacc ttggccgtga ggacacgtgg 781 cctgcaccca ggtgtggctg tcaggacacc agcctggtgc ccatcctccc gacccctacc 841 cacttccatt cccgtggtct ccttgcactt tctcagttca gagttgtaca ctgtgtacat 901 ttggcatttg tgttattatt ttgcactgtt ttctgtcgtg tgtgttggga tgggatccca 961 ggccagggaa agcccgtgtc aatgaatgcc ggggacagag aggggcaggt tgaccgggac 1021 ttcaaagccg tgatcgtgaa tatcgagaac tgccattgtc gtctttatgt ccgcccacct 1081 agtgcttcca cttctatgca aatgcctcca agccattcac ttccccaatc ttgtcgttga 1141 tgggtatgtg tttaaaacat gcacggtgag gccgggcgca gtggcctcac gcctgtaatc

  7. DNA Fingerprinting Lab pp. 88-93 • We are different by about 0.1% in our genome (we have different genetic fingerprints) • 3.1 billion bp x 0.1% = 3,100,000 bp differences. • Restriction enzymes cut our DNA molecules at specific sequence, such as TTC*CAT, but not cut ATCCAT. • Since our DNAs are different, using the same restriction enzyme will cut different individuals into different lengths DNA fragments. • Large DNA swims slower in a DNA swimming pool. • Different individuals will have different DNA patterns  fingerprinting

  8. DNA Fingerprinting Lab pp. 88-93 • Prepare gel box: make a boat • Casting the gel: pour liquid agarose solution • Add comb and let gel solidify (~20 min) • Add buffer and samples • Run electrophoresis (~ 45 min) DNA swimming • Stain the gel (10-15 min) – dye binds DNA • Destain the gel (10-15 min) – Clear background • Identify the suspect

  9. Restriction Enzyme cut DNA at Specific sites specificity

  10. Ava I Anabaena variabilis C* C/T C G A/G G Bam HI Bacillus amyloliquefaciens G G A T C C Bacillus globigii A* G A T C T Eco RI Escherichia coli RY 13 G* A A T T C Eco RII Escherichia coli R245 * C C A/T G G Hae III Haemophilus aegyptius G G * C C Hha I Haemophilus haemolyticus G C G * C Hind III Haemophilus inflenzae Rd A* A G C T T Hpa I Haemophilus parainflenzae G T T * A A C Kpn I Klebsiella pneumoniae G G T A C * C Mbo I Moraxella bovis *G A T C Mbo I Moraxella bovis *G A T C Pst I Providencia stuartii C T G C A * G Sma I Serratia marcescens C C C * G G G SstI Streptomyces stanford G A G C T * C Sal I Streptomyces albus G G * T C G A C Taq I Thermophilus aquaticus T * C G A Xma I Xanthamonas malvacearum C * C C G G G Bgl 2

  11. Gel Electrophoresis Load test samples here Large piece of DNA Small piece of DNA

  12. Restriction Fragment Length Polymorphism

  13. Restriction Fragment Length Polymorphism

  14. Restriction Fragment Length Polymorphism

  15. Restriction Fragment Length Polymorphism

  16. Gel Electrophoresis

  17. DNA Replication FreeNucleotides Parental DNA double helix New double helix with 1 old &1 new strand

  18. DNA  DNA Replication DNA Strand 1: ATCGGCCATDNAStrand 2:TAGCCGGTA DNA  RNA TranscriptionDNA Template: ATCGGCCATRNA Transcript:UAGCCGGUA

  19. 1. Build a single-stranded DNA molecule with 9 nucleotides 2. Build the complementary strand using the base-pairing rule (I.e.) A pairs with T; C pairs with G

  20. 3. Construct mRNA (Transcription) using either one of the two DNA strands as a template and the base-pairing rule (A with U; T with A) and ribose sugar

  21. DNA  DNA Replication DNA Template: ATCGGCCATDNAReplicate:TAGCCGGTA DNA  RNA TranscriptionDNA Template: ATCGGCCATRNA Transcript:UAGCCGGUA

  22. 4a. Translation: Add transfer RNA (triplet anticodon) 4b. Find Correct Amino Acids from Table  protein/peptide.

  23. Jargons used in Molecular Biology Restriction enzyme site Vector: an organism that carries a disease from one to another Genomic DNA and cDNA: introns and exons Insert Gel electrophoresis Transfection: infection of a cell with purified viral nucleic acid, or cDNA resulting in subsequent replication of the virus/cDNA in the cell. Polymerase chain reaction

  24. Composition of DNA ADENINE (A) GUANINE (G) • Amount of adenine relative to guanine differs among species • Amount of adenine always equals amount of thymine, and amount of guanine always equals amount of cytosine CYTOSINE (C) THYMINE (T) phosphate group deoxyribose A=T and G=C

  25. Composition of RNA ADENINE (A) GUANINE (G) • A, U, G, C (no T) • Single stranded • Smaller than DNA • From DNA  RNA is called transcription • Three types: • Messenger RNA • Transfer RNA • Ribosomal RNA Uracil (U) CYTOSINE (C) phosphate group Ribose A=U and G=C

  26. The Semiconservative Replication Model One DNAdouble helix SisterChromatids Both strands of original DNA serve as templates DuplicatedChromosome Chromosome Daughter chromosomes half old, half new

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer