330 likes | 381 Views
Chapter 10 Review. GMOs. Vectors and Hosts. DNA Fingerprinting. Sequencing and Replicating DNA. Gel electrophoresis. Tools of the Trade. 100. 100. 100. 100. 100. 100. 200. 200. 200. 200. 200. 200. 300. 300. 300. 300. 300. 300. 400. 400. 400. 400. 400. 400. 5 00.
E N D
GMOs Vectors and Hosts DNA Fingerprinting Sequencing and Replicating DNA Gel electrophoresis Tools of the Trade 100 100 100 100 100 100 200 200 200 200 200 200 300 300 300 300 300 300 400 400 400 400 400 400 500 500 500 500 500 500 f i n a l j e o p a r d y
GMOs 100 • What does “GMO” stand for?
GMOs 200 • What is the field that relates biological issues to human conduct and moral judgment?
GMOs 300 • How does the idea of bioremediation fit in with GMOs?
GMOs 400 • What is “Pharming”? How does it relate to GMOs?
GMOs 500 • Name a commercial plant product (whether it was actually sold or popular doesn’t matter) that is a GMO, and state what it did/does.
Vectors and Hosts 100 • The idea of removing genetic material from one organism and combining it with the genetic material of a different organism is referred to as…
Vectors and Hosts 200 • What is the difference between a host and a vector?
Vectors and Hosts 300 • What are our two options for vectors?
Vectors and Hosts 400 • List three characteristics that make a good host.
Vectors and Hosts 500 • Name one human disease mentioned, and compare prior treatments as opposed to new treatments.
DNA Fingerprinting 100 • What is one application / use of DNA Fingerprinting?
DNA Fingerprinting 200 • What are the three parts of the DNA molecule?
DNA Fingerprinting 300 • What are the small pieces of DNA that we compare in DNA fingerprinting called?
DNA Fingerprinting 400 • Whom can we exclude as suspects?
DNA Fingerprinting 500 • In the case of 2 year-old Rochelle, Marcus, you…….
Sequencing and Replicating DNA 100 • Nametheprocess
Sequencing and Replicating DNA 200 • Name the process
Sequencing and Replicating DNA 300 • What are the “ingredients” needed for PCR?
Sequencing and Replicating DNA 400 • What are the “ingredients” needed for the Sanger method?
Sequencing and Replicating DNA 500 • Why does sequencing stop when ddATP, ddGTP, ddTTP, or ddCTP is added?
Gel electrophoresis 100 • What is the goal of gel electrophoresis?
Gel electrophoresis 200 • What charge is DNA? What charge will it move towards in an electrophoresis chamber?
Gel electrophoresis 300 • What material is the gel made of? How does the size of DNA influence its movement?
Gel electrophoresis 400 • What is the carcinogenic chemical that is typically used to stain DNA and needs UV light to be seen?
Gel electrophoresis 500 • What are the variable sized pieces of DNA that are cut with restriction enzymes and are used in gel electrophoresis called?
Tools of the Trade 100 • What enzyme unzips the two strands of DNA? • What can be used in its place?
Tools of the Trade 200 • What is the enzyme that seals pieces of DNA together?
Tools of the Trade 300 • What enzyme makes a piece of complementary DNA from a piece of mRNA?
Tools of the Trade 400 • What is the difference between blunt and sticky ends
Tools of the Trade 500 • How many fragments would this piece of DNA be cut into? • BamHI: G|GGAT CCC CTAG|GG TAGGGATCCTATAGGGATCCGGGGGATCC ATCCCTAGGATATCCCTAGGCCCCCTAGG
FINAL JEOPARDY • How do the sons and daughters relate to “Mom” and “Dad”?