1 / 11

Protein Synthesis

Protein Synthesis. DNA structure. (see video). DNA vs. RNA. Dna vs. rna. (see video). Central dogma. DNA is used to make RNA, and RNA is used to make proteins. DNA  RNA  protein. transcription. translation. TRanscription. Occurs in nucleus

fran
Download Presentation

Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Protein Synthesis

  2. DNA structure (see video)

  3. DNA vs. RNA

  4. Dnavs.rna (see video)

  5. Central dogma • DNA is used to make RNA, and RNA is used to make proteins. DNA  RNA  protein transcription translation

  6. TRanscription • Occurs in nucleus • RNA polymerase copies a gene from DNA • DNA used as a template • mRNA created, then leaves the nucleus

  7. TRanscription (see video)

  8. translation (see video)

  9. translation • Occurs on a ribosome • 1. Ribosome uses rRNA to find start codon (sets the reading frame) • 2. First tRNAwith complimentary anti-codon attaches • 3. Next tRNA with complimentary anti-codon attaches • 4. Ribosome joins together the amino acids the tRNA molecules are carrying • 5. The ribosome continues joining amino acids until a special “stop” codon is reached

  10. Important ideas Non-Template DNA Template DNA GTCGATGTCTTCAAGGCCCTTGTCGTAGGGT CAGCTACAGAAGTTCCGGGAACAGCATCCCA GUCGAUGUCUUCAAGGCCCUUGUCGUAGGGU “reading frame” set once start codon (AUG) is located AGU AGA UAC AGC UCC AAC GGG STOP mRNA met ser asn gly ser arg ser Finished sequence of amino acids = polypeptide (protein) tRNA w/anti-codon carrying amino acid (amino acid names are abbreviated)

  11. Codon chart • Examples: • Codon #1 = • U A U • Codon #2 = • A G U • Codon #3 = • U A G

More Related