Protein Synthesis - PowerPoint PPT Presentation

fran
protein synthesis n.
Skip this Video
Loading SlideShow in 5 Seconds..
Protein Synthesis PowerPoint Presentation
Download Presentation
Protein Synthesis

play fullscreen
1 / 11
Download Presentation
Protein Synthesis
92 Views
Download Presentation

Protein Synthesis

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Protein Synthesis

  2. DNA structure (see video)

  3. DNA vs. RNA

  4. Dnavs.rna (see video)

  5. Central dogma • DNA is used to make RNA, and RNA is used to make proteins. DNA  RNA  protein transcription translation

  6. TRanscription • Occurs in nucleus • RNA polymerase copies a gene from DNA • DNA used as a template • mRNA created, then leaves the nucleus

  7. TRanscription (see video)

  8. translation (see video)

  9. translation • Occurs on a ribosome • 1. Ribosome uses rRNA to find start codon (sets the reading frame) • 2. First tRNAwith complimentary anti-codon attaches • 3. Next tRNA with complimentary anti-codon attaches • 4. Ribosome joins together the amino acids the tRNA molecules are carrying • 5. The ribosome continues joining amino acids until a special “stop” codon is reached

  10. Important ideas Non-Template DNA Template DNA GTCGATGTCTTCAAGGCCCTTGTCGTAGGGT CAGCTACAGAAGTTCCGGGAACAGCATCCCA GUCGAUGUCUUCAAGGCCCUUGUCGUAGGGU “reading frame” set once start codon (AUG) is located AGU AGA UAC AGC UCC AAC GGG STOP mRNA met ser asn gly ser arg ser Finished sequence of amino acids = polypeptide (protein) tRNA w/anti-codon carrying amino acid (amino acid names are abbreviated)

  11. Codon chart • Examples: • Codon #1 = • U A U • Codon #2 = • A G U • Codon #3 = • U A G