INDM 3007
Download
1 / 14

INDM 3007 - PowerPoint PPT Presentation


  • 126 Views
  • Uploaded on

INDM 3007. Lecture 5. Rpol. This is typical for transcriptional activators. Repressor binding sites often overlap the promoter. Exception: activators of sigma-54 RNA polymerase These bind far upstream, more common for eukaryotic promoters. lysR proteins bind adjacent to the CbbR promoter.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'INDM 3007' - fola


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
Indm 3007

INDM 3007

Lecture 5


Indm 3007

Rpol

This is typical for transcriptional activators

Repressor binding sites often overlap the promoter

Exception: activators of sigma-54 RNA polymerase

These bind far upstream, more common for eukaryotic promoters

lysR proteins bind adjacent to the CbbR promoter


Indm 3007

Conclusion from previous: two LysR dimers bind side by side to the same side of the DNA helix

Proper orientation between proteins bound to DNA is extremely important

Facilititates protein protein contacts

Essential for transcriptional activation

cooperative binding


Indm 3007

One protein-DNA to the same side of the DNA helix

Complex

No protein-DNA

interaction

IR1

IR2

IR3

GCCACTTCAGATTTCCTGAATGCCTACTTCATATCATTTAAATTTACCTGAAATCGGCGCGGGGGCA

Conclusion:

strong binding to binding site 1

binding to binding site 2 requires CbbR at binding site 1


Indm 3007

GCCAC to the same side of the DNA helixTTCAGATTTCCTGAATGCCTACTTCATATCATTTAAATTTACCTGAAATCGGCGCGGGGGCA

5

0

GC

CT

6

0

GC

CT

10

66

GC

CT

CT

12

0

GC

14

0

GC

CT

cbbR

Cbb operon

Promoter

Activity (%)

Spacing (nt)


Indm 3007

Effect of spacing to the same side of the DNA helix

Cbb operon

Spacing

0, 10 bp

RNA polymerase

CbbR

Spacing

5, 6, 12,14 bp


Indm 3007

Conclusion binding between CbbR molecules is cooperative to the same side of the DNA helix

Cooperative binding: binding of a protein to binding site 1 helps binding of a second protein to binding site 2

Common for LysR type proteins, and many other regulatory proteins

Dependent on protein protein interactions


Indm 3007

Chemical signal to the same side of the DNA helix

Binding to regulator

Activation of transcription

Transcriptional regulators are switches: turn RNA polymerase ON and OFF

Signal about physiological state of the cell

What is the chemical signal for CbbR???


Indm 3007

200 uM to the same side of the DNA helix

No addition

NADPH

NADP+

NADH

NAD+

Complex 1

Complex 2

Free Fragment

LysR type proteins bind to DNA in the absence of an effector molecule

BUT binding is increased 3 fold in the presence of an effector

Allowed identification of effector molecule for CbbR

Conclusion: NADPH is the effector


Indm 3007

RNA pol to the same side of the DNA helix

RNA pol

Binding of the effector to the regulator activates the activator

How does this affect transcription?

Many transcriptional regulators affect DNA architecture, e.g., bending

LysR type regulators induce a bend in the DNA, relaxed after binding of the effector


Indm 3007

Isolation of suppressor mutants, promoter now active to the same side of the DNA helix

Promoter inactive

Promoter fused to lacZ as reporter gene

Relaxation of DNA bending may serve to produce productive contacts between RNA polymerase alpha subunit and the LysR-type activator

How do we know???

LysR mutants have been constructed which prevent activation of transcription


Indm 3007

Alpha subunits to the same side of the DNA helix

Suppressor mutations for OxyR and CysB (LysR type proteins)

Alpha subunit gene

Suppressor mutants are analysed: mutations map to alpha subunit

Relaxation of DNA bend may serve to produce productive contacts between activator and RNA polymerase


Indm 3007

Signal recognition domain to the same side of the DNA helix

Hinge region

DNA binding domain and

RNA polymerase contact domain

LysR type proteins are examples of simple transcriptional regulators

One protein binds to DNA

Recognises the ‘signal’

Transduces the signal to RNA polymerase

Other examples are: CRP, FNR and lacI


Indm 3007

LysR type proteins to the same side of the DNA helix

  • Are often a dimer of identical subunits

  • Two dimers bind side by side adjacent to promoter

  • Binding of the dimers is cooperative

  • recognise a low molecular weight compound, ie NADPH

  • DNA binding occurs in absence of effector but is increased upon binding of effector

  • Introduce a bend in the DNA

  • Bending is decreased upon binding of the effector

  • Contact the alpha subunit of RNA polymerase

  • Contacts could affect RNA polymerase binding or open complex formation