jed
Uploaded by
13 SLIDES
361 VIEWS
130LIKES

INDM 3007

DESCRIPTION

INDM 3007. Lecture 9. Proteins interact with DNA: how do they know where to bind?. DNA appears to a homogenous molecule, no specific features to recognise is this true?. What is unique to a particular stretch of DNA? Local shape of DNA Nucleotide sequence.

1 / 13

Download Presentation

INDM 3007

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. INDM 3007 Lecture 9

  2. Proteins interact with DNA: how do they know where to bind? DNA appears to a homogenous molecule, no specific features to recognise is this true? What is unique to a particular stretch of DNA? Local shape of DNA Nucleotide sequence DNA binding proteins use these two features to recognise a particular sequence

  3. The morphology of DNA is dependent on the DNA sequence. Some sequences introduce bends in DNA for example These structural features are recognised by proteins, much like in the ‘lock and key model’ for enzymes Local DNA structure DNA is not a straight tube

  4. The DNA helix has two ‘grooves’: the major groove the minor groove to which proteins bind The nucleotide bases are on the inside of the helix DNA binding proteins do not open the helix, so what do they recognise? DNA binding proteins ‘see’ the edges of the basepairs in the major or minor groove

  5. The protein ‘sees’ a particular array of these, which is different for each of the four base pairs Note that the edge pattern for G:C is different than the one for C:G What is it that these proteins interact with: Hydrogen bond donors Hydrogen bond acceptors Hydrophobic residues

  6. These are the edge patterns a DNA binding protein would ‘see’ Notice that in the major groove, every base pair has a unique pattern, wherease the minor groove only has two distinct patterns. The major groove is therefore more informative than the minor groove

  7. Based on structure comparisons it turned out that many bacterial DNA binding proteins contain a conserved domain of two alpha helices: helix-turn-helix motif What parts of the protein are involved in DNA recognition Mutations in helix 2 prevent DNA binding, which can be suppressed by mutations in the DNA sequence of the operator Swapping helix 2 between two different repressors also swapped the operator to which the proteins bind This shows that helix 2 is involved in DNA recognition

  8. Using X-Ray crystallography to determine the 3-D structures of proteins bound to DNA, the protein domains binding to DNA were revealed Rasmol pictures Helix 2 inserts into the major groove of DNA, whereas helix 1 lies across the groove Helix 2 interacts with the base pair edges Helix 1 contacts the sugar phosphate backbone How does this work?

  9. Specific amino acids, on the side of the helix facing DNA, interact with the base pair edges through hydrogen bonding The number of interactions between helix 2 and the DNA sequence determines the strenghth of DNA binding. Helix turn helix motif of Cro repressor protein (phage Lambda) Interaction between Cro and DNA Explains why the same protein can bind to different, yet related sequences with different affinities. We saw this for the LysR type proteins!

  10. helix helix GCCACTTCAGATTTCCTGAATGCCTAC Many DNA binding proteins are dimers, e.g, the LysR type proteins and CAP This means that there are two helix-turn-helix motifs per dimeric protein These will interact with two adjacent major grooves, ie 10 bp apart (CbbR binding site, lecture 5) The DNA recognition site is therefore frequently an inverted repeat

  11. The helix-turn-helix motif is often employed by bacterial DNA binding proteins, but there are other motifs. Zinc finger Leucine zipper Will be discussed by Patrick Caffrey Non specific DNA binding proteins do not have sequence specific interactions with DNA. Histones for example rely on electrostatic interactions: DNA phosphate back bone is negatively charged Protein is positively charged.

  12. It allows regulators binding far upstream (see lecture 5) to contact the RNA polymerase Integration host factor, IHF, is another example of proteins that do not make use of a HTH motif to bind to DNA This protein induces an 180o bend in the DNA Sigma54 RNA pol

  13. DNA protein interactions • Proteins can bind aspecifically to DNA using electrostatic interactions, e.g. histones • Specific DNA interactions frequently involve a helix-turn-helix domain, but there are other domains as well • Helix 2 of the helix turn helix motif, the recognition helix, contacts base pairs in the major groove of DNA • The base edges are recognised by this helix, the DNA helix is not opened up • Most DNA binding proteins are dimers and bind to an inverted repeat sequence in DNA • Many proteins recognise the local structure of DNA, e.g, sequence induced DNA bending

More Related