240 likes | 346 Views
What’s living in your water?™. DNA-Based Microbial Analysis Microbe Detectives Trevor Ghylin, P. E . Global Water Center, Milwaukee, WI. trevor.ghylin @microbedetectives.com 414-217- 7784 www.microbedetectives.com. Company Introduction. My Background Professional Engineer – CH2M Hill
E N D
What’s living in your water?™ DNA-Based Microbial Analysis Microbe DetectivesTrevor Ghylin, P. E. Global Water Center, Milwaukee, WI trevor.ghylin@microbedetectives.com 414-217-7784www.microbedetectives.com
Company Introduction • My Background • Professional Engineer – CH2M Hill • WEF CanhamGraduate Studies Fellowship • NIH Biotechnology Training Program Fellow • PhD Candidate – Biotechnology • Founded in 2012 to improve access to DNA sequencing services • Global Freshwater Seed Accelerator Winner • Rising Star Award - Early Stage Symposium • Advisory Board - Current and former IWA presidents • Key Developers - Biomolecular Engineer, Bioinformaticist • Clients – CH2M Hill, Milwaukee Water, Consulting Firms
Current paradigm Problem: >99% of microbes can’t be cultured or identified under a microscope
DNA-Based Microbial Analysis Sterilize, Preserve, Ship Add ethanol to 70% concentration to sterilize. Dilute with water to 25% for preservation and shipping (Shipping via Fedex: 5 days/$85USD/51GBP CollectEnvironmental Sample (50mL sterile bottle) Concentrate Centrifuge or Filtration Extract DNA/Purify DNA Sequencing PCR Amplification/DNA Sequencing ATGCATT…... Assign Taxonomy (Proprietary) Bioinformatics/DNA Processing/Taxonomic Assignment Nitrosomonas Healthy AOB population Interpretation of Results (Proprietary)
Example DNA Data >594682 TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTACGTAGGCGGACCCG TCAGTCAGTGGTGAAAGTTTGCAGCTTAACTGTAAAATTGCCATTGAAACTACGGGTCTT GAGTGTAAATGAGGTAGGCGGAATGTGTTGTGTAGCGGTGAAATGCTTAGATATAACACA GAACACCAATTGCGAAGGCAGCTTACTGGGATACAACTGACGCTGAGGCACGAAAGCGTG GGGATCAAACAGG >594511 TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAACGCAGGCTGGAGAT TAAGCGTGCTGTGAAATGTACCGGCTCAACCGGTGACGTGCAGCGCGAACTGGTTTCCTT GAGTGAGTACGACGTCAGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGATATCACGAA
Solution Cont’d • Novelty • Economically feasible • Proprietary DNA databases and microbial knowledge • Applications • Membrane Biofouling Troubleshooting • Wastewater Treatment Troubleshooting • Fecal Source Tracking • Drinking water distribution system monitoring and troubleshooting
Solution Cont’d • Benefits • Wastewater Treatment • Solve treatment problems • Reduce energy and chemical consumption • Maximisedigester energy production • Maximiseeffluent quality • Membrane Treatment • Solve Biofouling issues • Reduce chemical consumption • Reduce operational and maintenance labor • Increase membrane life • Drinking Water • Solve taste/odor issues • Solve coliform issues • Ensure quality and safety • Identify and fix distribution system issues
Wastewater Treatment • Municipal SBR – Filamentous Bulking in Spring • SVI~300 • Poor settling, poor effluent quality • Potential to exceed permit TSS limit
Costs • Project specific • Membrane Biofouling • $2,000USD (1,200 GBP) analysis (save >$10,000 USD/6,000GBP in chemical/operational) • Wastewater Treatment • $600USD (350 GBP) for 1 sample ($1000USD/600GBP) with microscopy) • Drinking Water • Provide distribution system insurance for pennies per resident • Business Model • Mail-in service business with additional consulting fee ($140/hr USD/85 GBP) • Return on investment can be extremely high
Status and Path Forward • Currently serving clients in drinking water and wastewater • Pilot studies • Wastewater Treatment • Year-long pilot; weekly or monthly samples • Drinking Water Distribution System • Single sampling event; collect samples from various locations in the distribution system • Multiple cities to generate more data • Membrane Biofouling
Status and Path Forward Cont’d • Plans • Pilot studies • Continue to serve clients and build our knowledge, refine our databases • Milwaukee distribution system project • Support Needed • Wastewater Treatment Demonstration • Membrane Biofouling Demonstration • Drinking Water Distribution System Demonstration
Summary and next steps • DNA analysis is economical • Superior to existing petri dish and microscopy methods • Need partners to do more extensive pilot testing work and demonstrate results • Reduced energy and chemical consumption • Improved drinking water quality • Improved membrane performance
Thank You What’s living in your water? Global Water Center, Milwaukee, WI trevor.ghylin@microbedetectives.com 414-217-7784www.microbedetectives.com LinkedIn: Trevor Ghylin