Dna technology
Download
1 / 11

DNA Technology - PowerPoint PPT Presentation


  • 54 Views
  • Uploaded on

DNA Technology. The Human Genome. The sequence of the nitrogenous bases found on the 23 pairs of chromosomes There are roughly 3 billion nitrogenous bases in one complete set. The Human Genome Project. 1990-2000s

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'DNA Technology' - egan


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

The human genome
The Human Genome

  • The sequence of the nitrogenous bases found on the 23 pairs of chromosomes

  • There are roughly 3 billion nitrogenous bases in one complete set


The human genome project
The Human Genome Project

  • 1990-2000s

    • A consortium of many scientists worked to sequence the entirety of the human genome

    • Francis Collins was Director of the publicly-funded part of the project

    • Craig Ventner was President of Celera Genomics, a private company


The human genome project1
The Human Genome Project

  • Controversy:

    • Who “owns” the sequence of the human genome?

    • A private company with the rights to this sequence would potentially be worth billions of dollars


The human genome project2
The Human Genome Project

  • In 2003, the HGP and Celera Genomics simultaneously published the sequence and released it on the internet for anyone to use


Chromosome 1
Chromosome 1

  • TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCAACCCTAACCCTAACCCTAACCCTAACCCTAA CCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCT AACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAAACCCTAAACCCTAACCCTAACCCTAACCCTA ACCCTAACCCCAACCCCAACCCCAACCCCAACCCCAACCCCAACCCTAACCCCTAACCCTAACCCTAACC CTACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCCTAACCCTAACCCTAACCCTA ACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAACCCTAACCCTCGCGGTACCCTCAGCCGGCCCG CCCGCCCGGGTCTGACCTGAGGAGAACTGTGCTCCGCCTTCAGAGTACCACCGAAATCTGTGCAGAGGAC AACGCAGCTCCGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAACGCAACTCCGCCGTTGCAAAGG CGCGCCGCGCCGGCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGAGGCGCGCCGCGCCG GCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGCAG AGAGGCGCGCCGCGCCGGCGCAGGCGCAGACACATGCTAGCGCGTCGGGGTGGAGGCGTGGCGCAGGCGC AGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGACACATGCTACCGCGTCCAGGGGTGGAGGCGTGGCGC AGGCGCAGAGAGGCGCACCGCGCCGGCGCAGGCGCAGAGACACATGCTAGCGCGTCCAGGGGTGGAGGCG TGGCGCAGGCGCAGAGACGCAAGCCTACGGGCGGGGGTTGGGGGGGCGTGTGTTGCAGGAGCAAAGTCGC ACGGCGCCGGGCTGGGGCGGGGGGAGGGTGGCGCCGTGCACGCGCAGAAACTCACGTCACGGTGGCGCGG CGCAGAGACGGGTAGAACCTCAGTAATCCGAAAAGCCGGGATCGACCGCCCCTTGCTTGCAGCCGGGCAC TACAGGACCCGCTTGCTCACGGTGCTGTGCCAGGGCGCCCCCTGCTGGCGACTAGGGCAACTGCAGGGCT CTCTTGCTTAGAGTGGTGGCCAGCGCCCCCTGCTGGCGCCGGGGCACTGCAGGGCCCTCTTGCTTACTGT ATAGTGGTGGCACGCCGCCTGCTGGCAGCTAGGGACATTGCAGGGTCCTCTTGCTCAAGGTGTAGTGGCA GCACGCCCACCTGCTGGCAGCTGGGGACACTGCCGGGCCCTCTTGCTCCAACAGTACTGGCGGATTATAG GGAAACACCCGGAGCATATGCTGTTTGGTCTCAGTAGACTCCTAAATATGGGATTCCTGGGTTTAAAAGT


Chromosome 11
Chromosome 1

  • AAAAAATAAATATGTTTAATTTGTGAACTGATTACCATCAGAATTGTACTGTTCTGTATCCCACCAGCAA TGTCTAGGAATGCCTGTTTCTCCACAAAGTGTTTACTTTTGGATTTTTGCCAGTCTAACAGGTGAAGCCC TGGAGATTCTTATTAGTGATTTGGGCTGGGGCCTGGCCATGTGTATTTTTTTAAATTTCCACTGATGATT TTGCTGCATGGCCGGTGTTGAGAATGACTGCGCAAATTTGCCGGATTTCCTTTGCTGTTCCTGCATGTAG TTTAAACGAGATTGCCAGCACCGGGTATCATTCACCATTTTTCTTTTCGTTAACTTGCCGTCAGCCTTTT CTTTGACCTCTTCTTTCTGTTCATGTGTATTTGCTGTCTCTTAGCCCAGACTTCCCGTGTCCTTTCCACC GGGCCTTTGAGAGGTCACAGGGTCTTGATGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTG CTGGCCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAG TGGGATGGGCCATTGTTCATCTTCTGGCCCCTGTTGTCTGCATGTAACTTAATACCACAACCAGGCATAG GGGAAAGATTGGAGGAAAGATGAGTGAGAGCATCAACTTCTCTCACAACCTAGGCCAGTAAGTAGTGCTT GTGCTCATCTCCTTGGCTGTGATACGTGGCCGGCCCTCGCTCCAGCAGCTGGACCCCTACCTGCCGTCTG CTGCCATCGGAGCCCAAAGCCGGGCTGTGACTGCTCAGACCAGCCGGCTGGAGGGAGGGGCTCAGCAGGT CTGGCTTTGGCCCTGGGAGAGCAGGTGGAAGATCAGGCAGGCCATCGCTGCCACAGAACCCAGTGGATTG GCCTAGGTGGGATCTCTGAGCTCAACAAGCCCTCTCTGGGTGGTAGGTGCAGAGACGGGAGGGGCAGAGC CGCAGGCACAGCCAAGAGGGCTGAAGAAATGGTAGAACGGAGCAGCTGGTGATGTGTGGGCCCACCGGCC CCAGGCTCCTGTCTCCCCCCAGGTGTGTGGTGATGCCAGGCATGCCCTTCCCCAGCATCAGGTCTCCAGA GCTGCAGAAGACGACGGCCGACTTGGATCACACTCTTGTGAGTGTCCCCAGTGTTGCAGAGGTGAGAGGA GAGTAGACAGTGAGTGGGAGTGGCGTCGCCCCTAGGGCTCTACGGGGCCGGCGTCTCCTGTCTCCTGGAG AGGCTTCGATGCCCCTCCACACCCTCTTGATCTTCCCTGTGATGTCATCTGGAGCCCTGCTGCTTGCGGT GGCCTATAAAGCCTCCTAGTCTGGCTCCAAGGCCTGGCAGAGTCTTTCCCAGGGAAAGCTACAAGCAGCA AACAGTCTGCATGGGTCATCCCCTTCACTCCCAGCTCAGAGCCCAGGCCAGGGGCCCCCAAGAAAGGCTC TGGTGGAGAACCTGTGCATGAAGGCTGTCAACCAGTCCATAGGCAAGCCTGGCTGCCTCCAGCTGGGTCG


Chromosome 12
Chromosome 1

  • ACAGACAGGGGCTGGAGAAGGGGAGAAGAGGAAAGTGAGGTTGCCTGCCCTGTCTCCTACCTGAGGCTGA GGAAGGAGAAGGGGATGCACTGTTGGGGAGGCAGCTGTAACTCAAAGCCTTAGCCTCTGTTCCCACGAAG GCAGGGCCATCAGGCACCAAAGGGATTCTGCCAGCATAGTGCTCCTGGACCAGTGATACACCCGGCACCC TGTCCTGGACACGCTGTTGGCCTGGATCTGAGCCCTGGTGGAGGTCAAAGCCACCTTTGGTTCTGCCATT GCTGCTGTGTGGAAGTTCACTCCTGCCTTTTCCTTTCCCTAGAGCCTCCACCACCCCGAGATCACATTTC TCACTGCCTTTTGTCTGCCCAGTTTCACCAGAAGTAGGCCTCTTCCTGACAGGCAGCTGCACCACTGCCT GGCGCTGTGCCCTTCCTTTGCTCTGCCCGCTGGAGACGGTGTTTGTCATGGGCCTGGTCTGCAGGGATCC TGCTACAAAGGTGAAACCCAGGAGAGTGTGGAGTCCAGAGTGTTGCCAGGACCCAGGCACAGGCATTAGT GCCCGTTGGAGAAAACAGGGGAATCCCGAAGAAATGGTGGGTCCTGGCCATCCGTGAGATCTTCCCAGGG CAGCTCCCCTCTGTGGAATCCAATCTGTCTTCCATCCTGCGTGGCCGAGGGCCAGGCTTCTCACTGGGCC TCTGCAGGAGGCTGCCATTTGTCCTGCCCACCTTCTTAGAAGCGAGACGGAGCAGACCCATCTGCTACTG CCCTTTCTATAATAACTAAAGTTAGCTGCCCTGGACTATTCACCCCCTAGTCTCAATTTAAGAAGATCCC CATGGCCACAGGGCCCCTGCCTGGGGGCTTGTCACCTCCCCCACCTTCTTCCTGAGTCATTCCTGCAGCC TTGCTCCCTAACCTGCCCCACAGCCTTGCCTGGATTTCTATCTCCCTGGCTTGGTGCCAGTTCCTCCAAG TCGATGGCACCTCCCTCCCTCTCAACCACTTGAGCAAACTCCAAGACATCTTCTACCCCAACACCAGCAA TTGTGCCAAGGGCCATTAGGCTCTCAGCATGACTATTTTTAGAGACCCCGTGTCTGTCACTGAAACCTTT TTTGTGGGAGACTATTCCTCCCATCTGCAACAGCTGCCCCTGCTGACTGCCCTTCTCTCCTCCCTCTCAT


Functional genomics
Functional Genomics

  • Now that the sequence is known, the next step is to understand it

  • Functional Genomics: the study of the genes, their functions and how they are controlled


The human genome1
The Human Genome

  • 3 billion nitrogenous bases in a set

  • Roughly 20,000 genes contained in the genome

  • Coding DNA makes up less than 2% of the genome

  • Non-coding DNA therefore is more than 98%

    • Is this DNA “junk” like many believe or does it server a purpose?


Further controversy
Further Controversy

  • Even though the sequence of the human genome is freely available, who “owns” the information?

  • If you make a discovery about some part of the human genome, how do you profit from it?

  • Cloning genes….