Fuel it up: Overexpression of ACC Sub-unit accC in E. coli for Enhanced Fatty Acid Accumulation

1. Over expression of Acetyl- CoA carboxylase (ACC) sub-unit accCin E.coli to enhance fatty acid (triacyl glycerol) accumulation for Bio-fuel production” “Fuel it up” Teammembers: ParulSirohi SanjuTimilsina

2. Introduction Biochemical pathway • The gene of interest in this project is accC ( Acetyl Co-A carboxylase biotin carboxylase).This gene catalyze the formation of malonyl-CoAsubstrate for biosynthesis of fatty acid synthesis. • ACC is a multi subunit( accA, accB, accC and accD) enzyme in most prokaryotes. It is also found in the chloroplast of most of plant and algae. • Fatty acid is the major prerequisite for bio-fuel production, so its over production might enhance bio-fuel production. • Overexpression of the enzyme DGAT is most likely to enhance lipid, Tri-acyl glycerol over production but due to high introns numbers in the source ( Arabidopsis thaliana) we chose ACC over DGAT. Source: NMD courchesne et.al./ journal of biotechnology 141(2009)31-41

3. Brief overview Source Organism: E. coli 0157:H7 Source: Biology department of University of Northern Iowa Media: Luria Broth Gene: Acetyl CoA carboxylase biotin carboxylase (accC) Assembly #: NC_011353.1 Region: 4242644..4243993 bp:1350 Introns: none ( prokaryote) Bio-brick Compatibility: Compatible

4. PCR Primer Sequence for accC gene Primers: • 24F_Biofuel1P 5’gaattctctagaatgctggataaaattgttattgccaaccgc 3’ • 24RP_Biofuel2S 5’ctgcagactaga cgagttttttctccagatagtggatgttagtgc3’ • 24F_Biofuel1 5’ atgctggataaaattgttattgccaaccgc 3’ • 24RP_Biofuel2 5’ cgagttttttctccagatagtggatgttagtgc3’

5. Gene sequence with primers: Forward primer: 5’gaattctctagaatgctggataaaattgttattgccaaccgc 3’      1 atgctggataaaattgttattgccaaccgcggcgagattgcattgcgtattcttcgtgcc      61 tgtaaagaactgggcatcaagactgtcgctgtgcactccagcgcggatcgcgatctaaaa     121 cacgtattactggcagatgaaacggtctgtattggccctgctccgtcagtaaaaagttat     181 ctgaacatcccggcaatcatcagcgccgctgaaatcaccggcgcagtagcaatccatccg     241 ggttacggcttcctctccgagaacgccaactttgccgagcaggttgaacgctccggcttt     301 atcttcattggcccgaaagcagaaaccattcgcctgatgggcgacaaagtatccgcaatc     361 gcggcgatgaaaaaagcgggcgtcccttgcgtaccgggttctgacggcccgctgggcgac     421 gatatggataaaaaccgtgccattgctaaacgcattggttatccggtgattatcaaagcc     481 tccggcggcggcggtggtcgcggtatgcgcgtagtgcgcggcgacgctgaactggcacaa     541 tccatctccatgacccgtgcggaagcgaaagctgctttcagcaacgatatggtttacatg     601 gagaaatacctggaaaatcctcgccacgtcgagattcaggtactggctgacggtcagggc     661 aactctatctatctggcggaacgtgactgctccatgcagcgccgccaccagaaagtggtc     721 gaagaagcaccagcaccgggcattaccccggaactgcgtcgctacatcggcgaacgttgc     781 gctaaagcgtgtgttgatatcggctatcgcggtgcaggtactttcgagttcctgttcgaa     841 aacggcgagttctatttcatcgaaatgaacacccgtattcaggtagaacacccggttaca     901 gaaatgatcaccggcgttgacctgatcaaagaacagctgcgtatcgctgccggtcaaccg     961 ctgtcgatcaagcaagaagaagttcacgttcgcggccatgcggtggaatgtcgtatcaac    1021 gccgaagatccgaacaccttcctgccaagtccgggcaaaatcacccgtttccacgcacct    1081 ggcggttttggcgtacgttgggagtctcatatctacgcgggctacaccgtaccgccgtac    1141 tatgactcaatgatcggtaagctgatttgctacggtgaaaaccgtgacgtggcgattgcc    1201 cgcatgaagaatgcgctgcaggagctgatcatcgacggtatcaaaaccaacgttgatctg    1261 cagatccgcatcatgaatgacgagaacttccagcatggtggcactaacatccactatctggagaaaaaactcggtcttcaggaaaaataa3’Cgtgattgtaggtgatagacctcttttttgagcagatcagacgtc5’ Reverse Primer

6. Vector Plasmid pSB1A3 pSB1A3 is a high copy number plasmid carrying Ampicillin resistance pSB1A3 is a bio-brick compatible plasmid that has prefix(E-X) and suffix(S-P) once in the whole sequence Its is also compatible for the constitutive promoter family member

7. Promoter/Regulator • Part: BBa_J23100 • Constitutive promoter family member is the consensus promoter sequence and is the strongest member of the family • RFP(au) of the J23100 is 2547 fold more than in wild type, which means it has 2547 fold more ability to increase enzymatic activity of enzyme in the biochemical pathway • Sequence: ttgacggctagctcagtcctaggtacagtgctagc • Alternative Promoters: • J23113:RFP- 21 ctgatggctagctcagtcctagggattatgctagc • J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc

8. Steps • Grow the source organism (E. coli) in LB media • DNA extraction from the source (E. coli) • Electrophoresis to check desired DNA segment (bp) • Primer designing • Multiplication of gene of interest by PCR • Electrophorosis • Digestion of Plasmid by restriction enzymes ( cut plasmid with S+P i.e bp2 and gene of interest with X+P i.ebp 2149 and P at bp20 ) • Ligation of accC gene in plasmid vector (pSB1A3) • Transformation of vector plasmid into host organism E. coli • Cloning of cells in a LB media • Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin) • Inoculation of E.coli in biomass • Testing of fatty acid (tri acyl glycerol) by thin layer chromatography -Materials for TLC: Silica gel, -Solvent mixture hexane/diethyl ether/acetic acid(17/3/0.2/v/v/v) -CuSO4 reagent ( 20g CuSO4, 200ml methanol, 8ml H2SO4 and 8ml H3PO4)) -acetone/ toluene/ water( 91/30/8,v/v/v)

9. References • Magnuson, K., Jackowski, S. Rock,C.O., and Cronan, J.E.1993.Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522 • NoemieManuelle Dorval Courchesne, Albert Parisien, Bei Wang, Christopher Q. lan 2009 Enhancement of lipid production using biochemical, genetic and transcription factor engineering approches, Journal of botechnology • http://partsregistry.org/Main_Page • http://www.ncbi.nlm.nih.gov/ • http://scholar.google.com/

10. Goal: To overexpressed accC gene in E.coli to increases Tri acyl glycerol (TAG) production then our future goal will be to express the accC gene in any possible microorganisms ( Algae and bacteria) which might enhance lipid production in waste biomass.