edie
Uploaded by
70 SLIDES
976 VIEWS
710LIKES

Lecture 5

DESCRIPTION

Lecture 5. The history of comparative embryology and the 20 th century dissociation between development and evolution Modern evolutionary developmental biology (EvoDevo). Pre-Darwinian concept of evolution. Human Fish Worm Protozoan. Ontogeny, Phylogeny. ‘Transformationism’.

1 / 70

Download Presentation

Lecture 5

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Lecture 5 • The history of comparative embryology and the 20th century dissociation between development and evolution • Modern evolutionary developmental biology (EvoDevo)

  2. Pre-Darwinian concept of evolution Human Fish Worm Protozoan Ontogeny, Phylogeny ‘Transformationism’

  3. Karl Ernst von Baer (1792-1876): Embryologist, anti-transformationist (and creationist)

  4. Von Baer’s Four Principles • The general features of a large group of animals appear earlier than do the specialized features of a smaller group 2) Less general characters develop from the more general, until finally the most specialized appear 3) The embryo of a given species, instead of passing through the adult stages of lower animals, departs more and more from them 4) Therefore, the early embryo of a higher animal is never like a lower animal, but only like its early embryo

  5. Trochophore type embryos Polychaete worm Bivalve mollusc (clam) Vestimentiferan

  6. Dipleurula type embryos Sea urchin Brittle star Sea star Acorn worm Echinoderms Hemichordate Sea urchin Brittle star Sea cucumber Sea star

  7. Charles Darwin co-opted von Baer’s comparative embryology as evidence for evolution

  8. Ernst Haeckel (1834-1919): Naturalist, Philosopher, Transformationist Biogenetic law: “Ontogeny recapitulates phylogeny”

  9. The 20th century divorce and reconciliation between embryology and evolutionary biology • Divorce: • The late-19th century rise of Entwicklungsmechanik arose in part in reaction to Haeckel • The nucleus-cytoplasm controversy in embryology gave birth to genetics as a distinct field removed from embryology • Embryologists remained fixated on cell signaling and cytoplasm • The Modern Synthesis (of genetics and Darwinian evolutionary biology) considered embryology to be irrelevant

  10. Figure 4.1 E. B. Wilson (1856–1939) (A) and Thomas Hunt Morgan (1866–1945) (B)

  11. Figure 4.2 Theodor Boveri (1862–1915) (A) and Nettie M. Stevens (1861–1912) (B)

  12. Figure 4.3 Frank Lillie (A), Hans Spemann (left) and Ross Harrison (right) (B), Ernest E. Just (C).

  13. The 20th century divorce and reconciliation between embryology and evolutionary biology • Reconciliation • The developmental genetics pioneered by C.H. Waddington and others • The writings of Stephen J. Gould and others in the 1970s • The discovery of Hox genes in the 1980s • Revival of EvoDevo in the late 20th century

  14. Figure 4.4 Salome Gluecksohn-Schoenheimer (Now S. Gluecksohn-Waelsch) (A),and Conrad Hal Waddington (B). Developmental reaction norm Canalization Genetic assimilation of environmentally-induced characters (see also: Richard Goldschmidt, I. Schmalhausen) Brachyury mutant

  15. Developmental reaction norm Figure 3   Temperature shocking Aglais urticae produces phenocopies of geographic variants. (A) Usual central European variant; (B) heat-shock phenocopy resembling Sardinian form; (C) a Sardinian form of the species. (After Goldschmidt 1938.)

  16. Canalization Genetic or environmental change Phenotype (reaction norm)

  17. Genetic assimilation

  18. Stephen J. Gould Developmental heterochronies and the importance of gene regulation

  19. .. Ed Lewis, Christianne Nusslein-Volhard, and Eric Wieschaus Discoveries of developmental regulatory genes Bithorax mutant

  20. Scenario of insect evolution proposed by Ed Lewis based on homeotic mutations like bithorax

  21. Discovery of the Homeobox (Hox) in1984

  22. Modern evolutionary developmental biology (EvoDevo) • What is the structure of the tree of life?

  23. Figure 23.1(1) Relationships among Phyla

  24. Modern evolutionary developmental biology (EvoDevo) • What is the structure of the tree of life? • How do differences and similarities among organisms correlate with developmental genetics?

  25. Structural Information Regulatory Information …ACGTGATAACCGTCGATGTGGTCTGAGCATCAATGCATATTACTGAC… DNA: …TGCACTATTGGCAGCTACACCAGACTCGTAGTTACGTATAATGACTG… Transcription Amino Acid Codons RNA: GAGCAUCAAUGCAUAUUACUGAC… Translation M H I T D… Protein:

  26. Structural Information Regulatory Information …ACGTGATAACCGTCGATGTGGTCTGAGCATCAATGCATATTACTGAC… DNA: …TGCACTATTGGCAGCTACACCAGACTCGTAGTTACGTATAATGACTG… * * * *Potential targets of evolutionary mutation

  27. Modern evolutionary developmental biology (EvoDevo) • What is the structure of the tree of life? • Phylogeny reconstruction • Molecular distances • Character matrices (anatomy, gene expression, etc.)

  28. Bioinformatics and Genomics

  29. Multiple Sequence Alignments

  30. Phylogenetic trees SpRunt-2 -1 Rennert et al., BMC Evol. Biol. 3: 4, 2003

  31. ! Runx Gene Evolution

  32. Runx Gene Evolution

  33. Runx Gene Evolution

  34. Modern evolutionary developmental biology (EvoDevo) • What is the structure of the tree of life? • Phylogeny reconstruction • Molecular distances • Character matrices (anatomy, gene expression, etc.) • How do differences and similarities among organisms correlate with developmental genetics? • Gene expression (esp. regulatory genes) • Gene function (changes in protein structure or gene regulation/expression) • GRN architecture

  35. Example: Homeobox (HOX) gene evolution • ‘Downstream’ cis-regulatory changes in Hox target genes • ‘Upstream’ changes in the regulation/pattern of Hox gene expression • Changes in Hox protein structure/function • Changes in Hox gene number

  36. Figure 23.2 Expression of Regulatory Transcription Factors in Drosophila and in Vertebrates Along the Anterior-Posterior Axis

  37. Example: Homeobox (HOX) gene evolution • ‘Downstream’ cis-regulatory changes in Hox target genes • ‘Upstream’ changes in the regulation/pattern of Hox gene expression • Changes in Hox protein structure/function • Changes in Hox gene number

  38. Figure 23.3 Differences in Larval and Adult Morphology Due to Hox Gene Differences Upstream changes in Hox regulation (Ubx, AbdA) Downstream changes in Hox target genes

  39. Figure 23.4 Distal-Less Gene Expression in the Larva of the Buckeye Butterfly, Precis Upstream changes in Hox regulation (Ubx, AbdA) Sean Carroll

  40. Figure 23.5(1) “Holes” in the Expression of abdA and Ubx in the Abdomenof the Larval Butterfly Precis Upstream changes in Hox regulation (Ubx, AbdA) Sean Carroll

More Related