190 likes | 207 Views
Vectors. Timothy G. Standish, Ph. D. Vectors. If a fragment of DNA is ligated into an appropriate vector, it can be inserted into cells which will then make many copies of it
E N D
Vectors Timothy G. Standish, Ph. D.
Vectors • If a fragment of DNA is ligated into an appropriate vector, it can be inserted into cells which will then make many copies of it • Vectors are typically plasmids or viruses that have been engineered to both accept DNA insertions and reproduce inside cells • Cloning is the process of inserting DNA encoding a gene of interest into a vector, then establishing it as a stable part of a cell line.
Ampr Gene aagcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgaattc HindIII SphI PstI SalI XbaI BamHI XmaI KpnI SstI EcoRI AccI SmaI BanII HincII BspMI 2,686 bp Multiple Cloning Site Lac Z Gene Origin of Replication pUC 18A Typical Plasmid
pUC 18 Sequence tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagcttgcatgcctgcaggtcgactctagaggatccccgggtaccgagctcgaattcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaaagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtc
EcoRI EcoRI GAATTC CTTAAG GAATTC CTTAAG 1 Digestion AATTC G G CTTAA 2 Annealing of sticky ends Ligase AATTC G G CTTAA 4 Recombinant DNA AATTC G G CTTAA 3 Ligation R. E.s and DNA Ligase Can be used to make recombinant DNA
Ampr R. E. Digestion R. E. Digestion pUC18 LacZ Host Cell Transformation of cells with the recombinant plasmid Cloning Into pUC18 Matching sticky ends anneal Addition of ligase joins nicks and makes a single recombinant plasmind
IPTG - Induces expression of lacZ X-Gal - A lactose analog which turns blue when split by b-galactosidase Ampicillin - Kills all bacteria that lack the plasmid So How Do You Know IfYou Cloned Something?
HOCH2 HOCH2 O O Galactose Glucose HO O OH HO OH HO OH X-Gal5-Bromo-4-chloro-3-indolyl b-D-galactopyranoside Lactose O-b-D-galactopyranosyl-(1->4)-b-D-glucopyranose
b-Galactosidease Lac Z gene product HOCH2 H2O O Galactose HO O Cl Br HO OH N H X-Gal5-Bromo-4-chloro-3-indolyl b-D-galactopyranoside X-Gal (Colorless)
b-Galactosidease HOCH2 O Galactose HO HO OH Cl Br HO OH N H X-Gal5-Bromo-4-chloro-3-indolyl b-D-galactopyranoside Blue
IPTG - Induces expression of lacZ X-Gal - A lactose analog which turns blue when split by b-galactosidase Ampicillin - Kills all bacteria that lack the plasmid So How Do You Know IfYou Cloned Something? Blue colonies - Express b-galactosidase which metabolizes colorless X-gal to blue and turn blue; thus lacZ is not disrupted and there is no foreign DNA cloned Cloned fragments disrupt lacZ; thus make no b-galactosidase and colonies remain white
Libraries • If all the DNA from an organism is digested with a restriction enzyme and cloned into a plasmid, many different recombinant plasmids will be made, each with a different fragment of DNA cloned into it • Once inserted into host cells or viruses, this collection of many different recombinant plasmids is called a “library” • When the whole genome of an organism is used as the starting point for cloning, it is called a “shotgun clone” • A library constructed using shotgun cloning may contain hundreds of thousands of different recombinant plasmids • Screening is the process of sifting through the library to find the clone of interest
The clone of interest A Library
Extract DNA Fragment DNA Insert into vector DNA Library in bacteria Screen library and grow up bacteria with clone of interest Strategy
Library Screening • Libraries tend to have a lot of clones, only one of which has the sequence of interest • Screening a library is the process of eliminating those clones that do not contain the sequence of interest and locating the clone that does • There two major techniques are used for screening: • Hybridization screening - In which DNA from a library is bound to a membrane, then the membrane is exposed to a probe that should base pair (hybridize) to the sequence of interest • Expression vectors may be used so that if the gene for a protein is cloned, the protein is made. To do this, you must be able to detect the protein
cDNA Libraries • Because of the large size of libraries and the tedium of screening, anything that can be done to limit library size is a good thing • Protein coding regions of most eukaryotic genomes make up only a small percentage of the total DNA (3% in humans) • Most cells only express a small subset of an organism’s genes • By using reverse transcriptase, a cDNA copies of the mRNA being produced in a group of cells can be made • Cloning cDNA to make a library produces a much smaller library enriched with the part of an organism’s genome that is of most interest
An Expression Vector Myc tag EK site MCS • pPROTet.E is a commercially available plasmid sold by Clontech • It is specifically designed to allow efficient control of expression AatII XbaI I II T1 Cmr pPROTet.E II ColE1 t0 SacI
mRNA 5’ AAAAAAAAAAA3’ Rev. Trans. Reverse transcription 5’ AAAAAAAAAAA3’ mRNA cDNA hybrid 5’ TTTTTTTTTTTT5’ 5’ AAAAAAAAAAA3’ cDNA after RNase treatment RN ase 5’ TTTTTTTTTTTT5’ A A A A A A A Double-stranded cDNA after DNA polymerase DNA Pol 5’ TTTTTTTTTTTT5’ 5’ AAAAAAAAAAA3’ Insert into vector cDNA Library Construction TTTTTTTTTTTT5’
The End