590 likes | 703 Views
WormBase: A Resource for the Biology & Genome of C. elegans. Lincoln D. Stein. WormBase Web Site. WormBase is a MOD. Model Organism Database Repository for reagents Genetic stocks, vectors, clones Genetic maps Large-scale data sets Genome, EST sets, microarrays, interactions Literature
E N D
WormBase: A Resource for the Biology & Genome of C. elegans Lincoln D. Stein
WormBase is a MOD • Model Organism Database • Repository for reagents • Genetic stocks, vectors, clones • Genetic maps • Large-scale data sets • Genome, EST sets, microarrays, interactions • Literature • Meetings, announcements, etc
Other MODs • FlyBase (Drosophila) • WormBase (Caenorhabditis) • SGD (Saccharomyces) • TAIR (Arabidopsis) • MGD (Mus) • PlasmoDB (Plasmodium) • RatDB (Rattus)
C. elegans FunFacts • 1.5 mm length • 2 week life span • 959 cells • 302 neurons • 6 chromosomes • 100,258,171 bp (95 Ns) • 19,000 genes • 2,000 mutant strains
WormBase FunFacts • 402,076 Sequences • 121,671 Proteins • 143,708 Clones • 24,728 Primer pairs • 15,022 Papers • 12,552 Loci • 2,944 Cells • 14 Maps • 7,200 RNAi results • 332 Transgenes • 19,713 Expression Patterns
mek-2 RNAi Studies Found a Genetic Locus: mek-2 mek-2 Phenotype & Expr Pattern
Bulk FTP Downloads • Genomic sequence • DNA (fasta) • Feature files (GFF) • C. briggsae DNA • ESTs (fasta) • WormPep • Non-coding RNAs • All the software (Open Source)
Recently Added: C. briggsae • C. elegans sequencing consortium (WashU + Sanger Center) • Whole genome shotgun + 12 Mb previously-finished BACs from WashU • 142 scaffolds • N50= 1,450 kb • 21,000 predicted genes • 11,000 genes orthologous to elegans
Accessing briggsae via elegans Corresponding region in briggsae
How WormBase Works Web server Images, Movies Perl scripts You Database access library Genomic Data ACeDB MySQL
.ace .ace .ace .ace .ace WormBase Information Workflow CalTech Sanger WashU NCBI CGC
.ace .ace .ace .ace .ace WormBase Information Workflow CalTech Sanger WashU NCBI CGC Sanger
.ace .ace .ace .ace .ace WormBase Information Workflow CalTech Sanger WashU NCBI CGC Sanger CSHL www.wormbase.org
.ace .ace .ace .ace .ace WormBase Information Workflow CalTech Sanger WashU NCBI CGC Sanger CalTech Caltech.wormbase.org CSHL www.wormbase.org
Curating a Paper Clipping Service Domain Expert Gene Record Database Entry Cell Record Mutant Record CalTechAce .ACE Files .ACE File
Curating the Genome (1) >CHROMOSOME_I gcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagc ctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcct aagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaa gcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagc ctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcct aagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaa gcctaag… Gene Prediction Repeat Finding EST Alignment List of Features
Curating the Genome (2) List of Features CamAce StlAce ACeDB Sequence Editor
CSHLAce Curating Other Data Sets GO Consortium Knockout Consortium RNAi Labs C. elegans Microarray Consortium ORFeome Project
Build Process CSHLAce StlAce CalTechAce CamAce integrate reconcile BuildAce WormBase
The GMOD Project • Generic Model Organism Database • Generic MOD web site • Database schemas • Standard operating procedures • Annotation tools • Analysis tools • Visualization tools http://www.gmod.org
Released Modules • Apollo genome annotation editor • GBrowse generic genome browser • PubSearch literature curation system • LabDoc SOP editor • CMap comparative map viewer • GOET ontology editor • Chado modular database schema