390 likes | 561 Views
The problem with human evolution …. So God created man in his own image, in the image of God created he him; male and female created he them. Gen 1 : 27. ?. Where did the monkey come from ?. Starting at the beginning. Starting at the beginning. What is life ?.
E N D
The problem with human evolution … So God created man in his own image, in the image of God created he him; male and female created he them. Gen 1 : 27 ? Where did the monkey come from ?
What is life ? can it be understood in material terms?
What is life ? • Able to live independently of parent • Has a metabolism that requires energy • Produces offspring identical to itself • Has DNA or RNA for reproduction • Molecules that have ‘chirality’ • Has a cellular structure All living organisms are said to have the following characteristics:
The important question Is it possible for living matter to originate from inert matter ? This is also known as spontaneous generation or abiogenesis.
Spontaneous Generation 1st Cent. BC The early Greek philosophers such as Anaximander, Aristotle and Lucretius believed that living organisms originated from mud heated from the sun. Your serpent of Egypt is bred now of your mud by the operation of your sun: so is your crocodile. Antony and Cleopatra: Act 2, written before the spring of 1608 On the Nature of Things By Lucretius Written 50 B.C.E
Spontaneous Generation 1500s ... if you press a piece of underwear soiled with sweat together with some wheat in an open mouth jar, after about 21 days the odour changes and the ferment coming out of the underwear and penetrating through the husks of the wheat, changes the wheat into mice. Flemish scientist Jan van Helmont (1580-1644)
Spontaneous Generation 1500s But what is more remarkable is that mice of both sexes emerge (from the wheat) and these mice successfully reproduce with mice born naturally from parents ... But what is even more remarkable is that the mice which came out were not small mice… but fully grown. Flemish scientist Jan van Helmont (1580-1644)
Spontaneous Generation 1600s In the seventeenth century Italian scientist Francesco Redi through experimentation developed the doctrine of “omne vivum ex vivo”All life comes from pre-existing life Italian scientist Francesco Redi (1626-1697)
Spontaneous Generation 1700s Erasmus Darwin proposed a modified theory of spontaneous generation in which only the simplest life forms spontaneously generated from which higher order life forms were derived. Erasmus Darwin (1731-1802) Organic life began beneath the waves.....Hence without parent by spontaneous birthRise the first specks of animated earth;From nature's womb the plant or insect swims,And buds or breathes with microscopic limbs." Organic life beneath the shoreless wavesWas born and nurs'd in ocean's pearly cavesFirst forms minute unseen by sphearic glass Move on the mud, or pierce the watery mass; These, as successive generations bloom,New powers acquire and larger limbs assume; Temple of Nature by Erasmus Darwin
Spontaneous Generation 1800s In the nineteenth century, famous French scientist Louis Pasteur entered the debate and through experiments proved that the supposedly spontaneously generated life forms had in fact come from micro-organisms which abound in the atmosphere. French chemist Louis Pasteur (1822-1895)
The primordial soup myth 1900s Spontaneous generation having been disproved, the battle field was moved to a time in the supposed primordial earth, when conditions were more favorable to the generation of life. Russian biochemist Aleksandr Ivanovich Oparin (1894-1980)
Heat for 1 million years and add lightning bolt The primordial soup myth 1900s “Life arose on earth thousands of millions of years ago when collections of organic molecules in the primeval soup which formed in the primitive ocean became isolated from the bulk water of that ocean. Because of their closeness these molecules were able to interact with one another and began to show the first signs of life.” E.J. Wood and W.R. Pickering, Introducing Biochemistry (1982) p. 17
The primordial soup myth 1900s
The Miller Experiment 1900s The most generally respected study on the origin of life via a primordial soup is the experiment conducted by the American researcher Stanley Miller in 1953.
The Miller Experiment 1900s • Used a “cold trap” to isolate the amino acids from the environment as soon as they were formed. • Unrealistic atmosphere simulated. Scientists now agree that nitrogen and carbon dioxide are required. • The atmosphere should also have had oxygen, which would have destroyed the newly formed amino acids. • Other organic acids also formed that were detrimental to the structure and function of living things. 4 key problems with this experiment:
Millers Experiment 1900s If I can just synthesize life here, then I’ll have proven that no intelligence was necessary to form life in the beginning
The primordial soup myth 1900s “It was popular not because there was any evidence to support it, but because it seemed to be the only alternative to Biblical creationism.” Physicist Freeman Dyson “It is remarkable that over the past half-century the scientific world has, almost without exception, believed a theory for which there is not a single supporting fact.” Sir Fred Hoyle
Molecular Chirality all molecules are not created equal
Molecular chirality The building block amino acids of all living things are 100% left handed. However, a hypothetical ‘soup’, by well-known laws of chemistry, would inevitably be an even racemic mixture of left and right-handed acids. Sarfati, J., The origin of life: the chirality problem, CEN Technical Journal12(3):281-284, 1998
Extra-Terrestrial Life move the problem somewhere else
400 to 54 million km from earth 400 000 km from earth Electron micrograph of Martian meteorite ALH84001 Life from Mars? The Moon : LIFELESS ! If life could not have started on Earth, it must have come from somewhere else – right ?
Life on Earth ? • Magnetosphere filtering out lethal solar radiation • Atmospheric gases of the exactly the right ratio • Earth tilted at a angle of 23° giving us our seasons • Position in relation to the gas giant planets and asteroid belt • The distance from and the tidal effect of the moon • Located within the Habitable Zone (HZ) Add 154 other factors!
The chemistry of life how to build a human
Elements - Atoms Nitrogen Hydrogen Oxygen Carbon Phosphorus If the nucleus of a typical atom were expanded to the size of a basket ball, the atom would be about a 3 km in diameter. Atoms are mostly empty space!
Adenine Cytosine Guanine Thymine Molecules Amino Acids Sugars DNA and RNA also use pure right-handed chiral sugar molecules All amino acid molecules in DNA are left handed chiral molecules
DNA - Deoxyribose Nucleic Acid DNA is such an incredibly complicated molecule that it is over six feet in length ! In a human being, each cell holds 46 separate DNA molecules, each containing, on the average, about 160 million nucleotide pairs, yet this massive amount of information is stored and replicated almost flawlessly. Nitrogen Hydrogen Oxygen Carbon Phosphorus
Genes The base pairs of amino acids act like a structural integrity test. Because only A & T join and C & G join, the two sugar backbones that make the DNA double helix are identical but in verse order. This ensures that in the case of a single amino acid being wrong the whole double helix structure is invalidated. Adenine + Thymine Thymine+Adenine Cytosine + Guanine Guanine + Cytosine ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG TAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGC TAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGC
Chromosomes All humans have 23 pairs of chromosomes. 22 regular pairs and an XY pair. Chromosomes exist in the nucleus of all of our 100 trillion cells and are essential discreet sections of the genetic code.
s Cells Some life forms are made of only a single cell Cells are where the atoms and molecules begin to demonstrate specific purpose and functional objectives – the first real evidence of intelligence
s The two most important cells
s Human Foetus As thou knowest not what is the way of the spirit, nor how the bones do grow in the womb of her that is with child: even so thou knowest not the works of God who maketh all. Ecclesiastes 11:5 A human life at about 12 weeks
I will praise thee; for I am fearfully and wonderfully made: marvellous are thy works; and that my soul knoweth right well.Psalms 139:14
The Last Word what has God said …
The invisible things … Romans 1:20 For the invisible things of him from the creation of the world are clearly seen, being understood by the things that are made, even his eternal power and Godhead; so that they are without excuse: Professing themselves to be wise, they became fools …