slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Issues affecting the calibration of Affymetrix GeneChips harry@essex.ac.uk PowerPoint Presentation
Download Presentation
Issues affecting the calibration of Affymetrix GeneChips harry@essex.ac.uk

Loading in 2 Seconds...

play fullscreen
1 / 46

Issues affecting the calibration of Affymetrix GeneChips harry@essex.ac.uk - PowerPoint PPT Presentation


  • 125 Views
  • Uploaded on

Issues affecting the calibration of Affymetrix GeneChips harry@essex.ac.uk. Overview of GeneChip technology and how gene expression is measured. How the data is calibrated. Biophysics of GeneChip technology. Biological issues such as splicing. Potential problems with parts of the data.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Issues affecting the calibration of Affymetrix GeneChips harry@essex.ac.uk' - dai-townsend


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide2

Overview of GeneChip technology and how gene expression is measured.

How the data is calibrated

Biophysics of GeneChip technology

Biological issues such as splicing

Potential problems with parts of the data

slide5

Detect fluorescence

Remove partial hybrids by washing in a solution with a reduced salt content (phosphate backbones of nucleic acids have negative charge).

Labelling with a fluorescent marker (on the Us).

Hybridization

Fragmentation of RNA to mean length of ~100 bases.

slide6

Reverse transcription has a chance of stopping at every base. This results in a population of aRNA copies which are biased towards the 3’ end.

slide7

Affymetrix microarrays

5’

3’

GTGGGAATTGGGTCAGAAGGACTGTGGCTAGG

GGAATTGGGTCAGAAGGACTGTGGC

GGAATTGGGTCACAAGGACTGTGGC

perfect match probe cells

mismatch probe cells

Probe-pairs scattered on chip

slide8

Probes can map to different transcripts. Such multiple targeting should be identified (Okoniewski and Miller BMC Bioinformatics 2006)

Some probes no longer map to the most update transcript information for a gene. These probes will not detect expression related to the rest of the probeset to which they belong.

There are a number of alternative Chip Definition Files, which group probes into probe-sets.

slide9

Probe cell (aka feature)

Perfect Match (PM)

Mismatch (MM)

Probe pair

Affymetrix probe set

slide10

Affymetrix software derives the intensity for each probe from the 75% quantile of the pixel values in each box.

slide11

Chip calibration

Correct Background, Normalise, Correct for Cross Hybridisation, Expression Measure

High-level analysis, biological interpretation

slide13

Chips need to be normalised against each other.

Each chip is a different colour

e.g. invariant genes, lowess, quantiles

slide14

PA PB PC PD PE

PA PB PC PD PE

Chip 1

Chip 1

Chip 1

Chip 1

1 2 3 4 5

1.33 2.33 3.33 4.66 7

1 2 4 3 5

1.33 2.33 4.66 3.33 7

Chip 2

Chip 2

Chip 2

Chip 2

1 2 3 5 7

7 2.33 4.66 3.33 1.33

7 2 5 3 1

1.33 2.33 3.33 4.66 7

Chip 3

Chip 3

Chip 3

Chip 3

4.66 2.33 3.33 1.33 7

1.33 2.33 3.33 4.66 7

2 3 4 5 9

5 3 4 2 9

Order by ranks

Average the intensities at each rank

Reorder by probe

RMA uses Quantile normalisation at the probe level

slide15

Expression Measure

The intensities of the multiple probes within a probeset are combined into ONE measure of expression

slide16

Cross Hybridisation

MAS 5.0 (Affymetrix) corrects for cross-hybridisation by subtracting the MisMatch signal from the Perfect-Match.

RMA ignore the mismatches because they hybridise to the Perfect Signal.

slide18

1-9 are different chips.

dChip and RMA ‘model’ the systematic hybridisation patterns when calibrating an expression measure.

slide20

Cross Hybridisation

MAS 5.0 (Affymetrix) corrects for cross-hybridisation by subtracting the MisMatch signal from the Perfect-Match.

RMA ignore the mismatches because they hybridise to the Perfect Signal.

How can you measure cross-hybridisation without using the MisMatch signal?

There is a need for a model of the physics of hybridisation (Naef and Magnasco 2003)

slide21

Size is important

e.g. perfect match #13 = A, so mismatch #13 is T, and the complementary base in mRNA is also T/U

T

Pyrimidines (C & T) are small

There will be no steric hindrance between the pyrimidine in the mismatch and the pyrimidine in the mRNA of interest.

C

Purines (G & A) are large

G

There will be a large steric hindrance between the purine in the mismatch and the purine in the mRNA of interest.

A

slide23

GC content is important

AT bonds have two hydrogen bonds.

GC have 3 hydrogen bonds

slide24

Probes are ssDNA

Target is RNA

slide25

Biotin labelling interferes with the hybridisation

C & T (pyrimidines) are labelled. So GC* binds less strongly than CG, and AT* binding is weaker than TA.

If the probe contains no C & T, it will hybridise well but with no fluorescence. If you have all C & T, it will have difficulty hybridising.

slide26

Van der Waals interactions between adjacent bases

H-bond interactions between adjacent bases

Nearest-neighbour interactions predict duplex kinetics and so sequence order is important (Santa Lucia)

The binding energy of GAC is not the same as CAG

slide27

Wu and Irizarry (2004) have written GCRMA (which is available in Bioconductor).

Lots of close sequences will hybridise to a given probe. Wu and Irizarry model the variation in hybridisation of these similar processes using a statistical model.

GCRMA determines the contribution to the PM from Signal and from Non-Specific Hybridisation

slide29

Once chips have gone through the DATCELExpression Measure process, changes in gene expression between conditions or over time can be observed.

m=log2(Fold Change), a=log2(Average Intensity)

The change in expression between two conditions for all the genes on an array can be viewed on a MA plot

slide30

Some genes are represented by multiple probe-sets.

Probe-set A

Probe-set B

If they are measuring the same gene the signals should be up and down regulated together!

Is that always true?

No

Stalteri and Harrison, 2007, BMC Bioinformatics, 8:13

slide32

Alternative Splicing results in different permutations of exons from the same gene. Sometimes introns are also included. Each of these permutations results in a different protein.

Alternative Splicing affects > 50% of our genes. It is the most obvious way in which 25,000 genes in the Human Genome can produce ~100,000 proteins.

slide33

Probes map to different exons. Because of alternative splicing, some of the exons may be upregulated whereas others may be downregulated.

slide34

Single poly(A) site

Alternative poly(A) sites in the 3’-mostexon

Alternative poly(A) sites in differentexons

Tian et al. (2000)

Alternative Polyadenylation

slide35

Probes map to different sides of a polyadenylation signal. Because of alternative polyadenylation, some of the probes may be upregulated whereas others may be downregulated.

slide36

Comparing probes with runs of Gs.

Number of contiguous Gs

Mean Correlation

3 0.14

4 0.42

5 0.49

6 0.62

7 0.75

We are only looking at a small fraction of the entire probe, yet it is dominating the effects across all experiments.

slide37

A tetrad of Guanines can bind to each other through Hoogsteen Hydrogen bonds with the help of a central cation. G-quadruplexes are prevalent in telomeres (single stranded DNA at the end of chromosomes). G-quadruplexes are thermally stable.

G-quadruplexes take a range of topologies.

slide38

Adjacent probes within a cell on a GeneChip have the same sequence – a run of Guanines will result in closely packed DNA with just the right properties to form quadruplexes.

Upton et al. 2008 BMC Genomics, 9, 613

slide39

Parallel G-quadruplexes have a left-handed helical twist.

We suggest 4 probes can efficiently form a “Maypole”. Outside the corset of the “G-spot”, the probes have little affinity for bases of the same sequence and the phosphate backbones will repel each other. Inside the G-spot the bases are on the inside and cannot bind target.

GGGG

slide40

Hybridization

kf

Probe + Target Duplex

kr

Dissociation

R is the Gas Constant, and T is temperature.

G = - RT ln K

All spontaneous physical and chemical changes take place in the direction of a decrease in free energy, G < 0

slide41

Phosphates on chains of nucleic acids have a negative charge.

There is a coulomb block of hybridization on microarrays (Vainrub and Pettitt 2002). The environment caused by probe-probe interactions acts to modify the hybridization of RNA.

Hagan and Chakraborty 2004, Journal of Chemical Physics

The strength of binding depends upon probe density

G = - RT ln K

slide42

GGGG

GGGG

GGGG

G = - RT ln K

Probes that are not bound in G-quadruplexes will have a reduced probe density in the immediate environment of the runs of Guanines. This will result in very effective nucleation, and binding, with respect to hybridization to the rest of the probe.

The binding will efficiently occur in the G-spot. Any RNA molecule with a run of Cs will hybridize. Thus, there will be enhanced correlations between all the probes that are able to form G-quadruplexes.

slide44

Kerkhoven et al. 2008, PLoS ONE 3(4): e1980

Probes containing GCCTCCC will hybridize to the primer spacer sequence that is attached to all aRNA prior to hybridization.

slide45

GeneChips require calibration in order to reliably combine the information from multiple probes.

Biophysics of GeneChip technology has been studied in a lot of detail – but there is still things to learn. Algorithms such as GCRMA attempt to provide a physics-based transformation between light and RNA concentration.

Biological issues such as splicing

Potential problems with particular sequences

slide46

Bioinformatix, Genomix, Mathematix, Physix, Statistix, Transcriptomix

are needed in order to extract reliable information from Affymetrix GeneChips

Thank you for your attention.