slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Nutrition and Gene Expression Jan 30, 2014 PowerPoint Presentation
Download Presentation
Nutrition and Gene Expression Jan 30, 2014

Loading in 2 Seconds...

  share
play fullscreen
1 / 15
Download Presentation

Nutrition and Gene Expression Jan 30, 2014 - PowerPoint PPT Presentation

chase
96 Views
Download Presentation

Nutrition and Gene Expression Jan 30, 2014

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Nutrition and Gene Expression Jan 30, 2014 -The role of the X-chromosome in heredity -Probability that recessive gene affects offspring -Mutations: how they occur, and when they have effects on health

  2. Female X-chromosome inactivation At the 2000-cell stage (approximately), a change occurs in cells of embryos of female mammals. It affects one of the X-chromosomes in each cell of the embryo. ONE of the two X-chromosome becomes permanently inactive. All the cells that descend from that cell show that pattern (except for cells that produce new ova). Why is this important? It prevents the “double dose” effect: the level of protein produced from either one of the active female X chromosomes is the same as the level of protein made from the single male X chromosome. The X chromosome that has been inactivated (called the Barr body) can be seen along the edge of the nuclear membrane: it is very compact, similar to chromosomes during mitosis, and its genes are mostly dormant. Barr body (condensed X-chromosome) in female epithelial cell (cell is NOT mitotic!) Male epithelial cell: no Barr body

  3. If a sample of tissue from a female is examined, it is observed that EITHER the maternal X or the paternal X chromosome is active (in almost all cells). The active chromosome can differ between adjacent tissues, as seen in a calico cat (which is always female). In the black fur, there is activity of a different X chromosome than the tan fur.

  4. What about human females? Does this pattern (called a mosaic) ever occur? RARELY, if a woman has the gene for Duchenne’s muscular dystrophy on one X chromosome, there will be SOME weakness in certain of her muscles where that version of the X chromosome is not active. But it’s only a mild disorder, and usually not a major problem. In a boy, with only that one copy of the gene, it’s a VERY serious disorder. Of some interest: about 1/3 of the time, an affected boy results from a NEW mutation in the gene for the protein dystrophin. The other 2/3 of the time, the mother is carrying the mutated gene on one of her two X-chromosomes. Another disorder carried on the X-chromosome leads to defective sweat gland production: heterozygous females may not be able to produce sweat from a PORTION of their epidermis. Affected boys need to be VERY careful to avoid being overheated, since they produce very little sweat at all. There are LOTS of genes on the X-chromosomes, and we are slowly identifying new genes where a mutation can be a serious problem for the male.

  5. THE RIDDLE OF HOW X-LINKED MUTATIONS ARE NOT ELIMINATED BY NATURAL SELECTION: The daughters are protected by the normal X, and can be healthy as carriers. The recessive X-linked genes can be transferred through generations of girl progeny. The X-chromosome, and any disorders linked to it, are transmitted by the mother to the male children, since the Y (but not the X) is provided by the father to the boy progeny.

  6. Statistics of inherited autosomal traits (very simplified): Suppose that 1% of the population carries a recessive trait (green hair) on chromosome 14? The odds of a marriage: 0.01 x 0.01 = .0001 = One in ten-thousand This assumes equal odds for marriage, regardless of the recessive trait. The odds of a child with green hair: only 1 offspring in 4 will be affected = One in forty thousand. The actual condition is FAR LESS prevalent than the recessive trait. The formula to be used: Rate of births with two recessive genes = (Rate of carriers in the population)2 x 0.25. Suppose the rate is only 0.001? Then: (.001 x 0.001) x ¼ = .00000025 = one in four million (very rare disorder). WE WILL WORK OUT EXAMPLES ON THE BOARD IN CLASS.

  7. GRAPH: Percent of children with two recessive genes (y axis), as a function of the the percent of people with one copy of the gene (x-axis). This assumes that marriage frequency is INDEPENDENT of the presence of the recessive gene.

  8. For example: 1 in 25 (4%) of the US population carries one allele of the cystic fibrosis mutation (the recessive trait is protective against cholera and typhoid, so it persists) About 1 birth in 2500 has actual cystic fibrosis (0.04 x 0.04 x 0.25). The gene is for a protein that regulates a chloride channel. If you have one good copy of the gene, you have no problems of any kind. If you have two defective copies: The disease is very very bad. Question for consideration: should screening for the CF gene be made generally available, so people can make reproductive decisions? The gene for the chloride channel regulator (CFTR) is found on Chromosome 7. In 75% of cases, the protein for the chloride channel regulator is missing the codon for an entire amino acid (Phe). As a result of the mutation, chloride and sodium transport are not normal.

  9. DNA AND GENETIC DISORDERS THE MAJORITY OF GENETIC DISORDERS ARE THE RESULT OF PROBLEMS THAT OCCUR IN MEIOSIS, OR FROM INHERITING TWO COPIES OF A RECESSIVE GENE. Problems in newborns from simple mutations are less common. The mutation rate is very low: the genes that a child inherits usually only differ at about 100 base pairs, from the genes in the parental DNA. Most of those sequence changes are harmless. WHAT CAN HAPPEN DURING MEIOSIS? For example. sometimes a chromosome (such as Chromosome 21) is copied twice during the formation of gametes (usually an ovum). The baby gets THREE copies: two maternal, and one paternal. It’s called Trisomy 21. There are many other trisomies, but most of them are embryonic lethal. We know about Trisomy 21, because children with that disorder often grow to reach adulthood. TRISOMY 21: visualized from metaphase chromosomes Prenatal diagnosis is now fairly simple. and is now a common procedure.

  10. DNA REPLICATION: If every gene was copied perfectly, the genes in the gametes would be identical to the parental genes.

  11. TACGATTACACGGATATATGC TACGATTACACGGATATATGC TACGATTACACGGATATATGC ATGCTAATGTGCCTAT ATACG ATGCTAATGTGCCTAT ATACG ATGCTAATGTGCCTAT ATACG This is what is supposed to happen TWO EXACT COPIES OF ORIGINAL DNA

  12. TACGATTACACGGATATATGC TACGATTACACGGATATATGC TACGATTACACAGATATATGC ATGCTAATGTGCCTAT ATACG ATGCTAATGTGCCTAT ATACG ATGCTAATGTGTCTAT ATACG BUT ONE COPY CAN HAVE THE WRONG DNA BASE! DEFECTIVE COPY

  13. TACGATTACACGGATATATGC TACGATTACACGGATATATGC TACGATTACACGATATGC ATGCTAATGTGCCTAT ATACG ATGCTAATGTGCCTAT ATACG ATGCTAATGTGCTATACG A WHOLE REGION CAN BE DELETED This copy has lost 3 bases from each strand

  14. You will be given a homework assignment to help you consider the EFFECTS that might occur with different mutations.

  15. How do we sequence genes? Using the most common technology, we prepare a large number of copies of a short DNA region (500-800 base pairs). We then sequence the region that with a method called DIDEOXY SEQUENCING. This provides the sequence for that DNA region. Technology is moving very fast: we are in the DEEP-SEQUENCING ERA. There are companies that will now sequence your entire genome for $5,000. The goal is to provide that for less than $1,000 (certain to be achieved by 2015). Of course, if your doctor has your COMPLETE DNA sequence, what use can be made of that? VERY CONTROVERSIAL. For example: we have lists of thousands of recessive and dominant mutations that cause health disorders. This technology will tell you which of these recessive genes (there are probably several) are in your genome.