Extração de DNA e RNA Enzimas de Restrição - PowerPoint PPT Presentation

slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Extração de DNA e RNA Enzimas de Restrição PowerPoint Presentation
Download Presentation
Extração de DNA e RNA Enzimas de Restrição

play fullscreen
1 / 32
Extração de DNA e RNA Enzimas de Restrição
901 Views
Download Presentation
cade
Download Presentation

Extração de DNA e RNA Enzimas de Restrição

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Universidade Federal de Santa Catarina Centro de Ciências Biológicas Laboratório de Polimorfismos Genéticos Extração de DNA e RNA Enzimas de Restrição

  2. Coleta de material biológico: Quando? De quem? Como? Tratamentos? Quanto mais fresco melhor! Quantidade aceitável Boa conservação EPI! Contenção!

  3. 1. Extração de DNA De onde podemos extrair DNA? • Sangue • Tecidos • Células de cultura • Extração plasmídeos de células bacterianas • Purificação de DNA de gel • ...

  4. 1. Extração de DNA Material de pacientes e controles - Lapoge Sangue total Buffycoats Amostras de tecido

  5. 1. Extração de DNA Objetivos? Objetivos PCR – tamanho? Integridade Pureza Quantidade Genotipagem? Sequenciamento? Quantificação de RNA - Expressão?

  6. 1. Extração de DNA Fundamentos • Lisar eritrócitos (choque osmótico) • Lisar leucócitos (detergentes) • Inativar DNAse (quelante -EDTA) • Precipitar/degradar proteínas (sais/proteinase) • Precipitar DNA (etanol) • Reidratação do DNA em água ou tampão

  7. 1. Extração de DNA Principais Métodos Fenol-Cloróformio Salting-out Kits com colunas

  8. 1. Extração de DNA Fenol-Cloróformio • Lise I: eritrócitos • Lise II: leucócitos • Fenol-clorofórmio • Precipitação etanol

  9. 1. Extração de DNA • Contaminação da amostra por fenol • Reagentes tóxicos! • Barato • Simples • Boa quantidade • Boa qualidade • Estabilidade do DNA

  10. 1. Extração de DNA Salting-out http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0365-05962008000300002

  11. 1. Extração de DNA Estabilidade do DNA? Sais contaminantes Barato Simples Boa quantidade Boa qualidade Não tóxico

  12. 1. Extração de DNA Kits

  13. 1. Extração de DNA Caro Estabilidade do DNA MUITO Simples Boa quantidade Boa qualidade Não tóxico

  14. 2. Extração de RNA Extração de RNA: Análises de expressão • Similar a extração de DNA • Protocolo bem mais cuidadoso • Molécula muito mais instável • Amostra pode ser bem conservado em TRIzol, RNAlater, etc.) - snapshot • É preciso separá-la do DNA • TRIzol • RNAlater • Kit com colunas

  15. 2. Extração de RNA TRIzol • Lise I: eritrócitos • TRIzol (fenol-guanidina) • Clorofórmio • Precipitação etanol Pode ser usado para extração de RNA, DNA e Proteínas!

  16. Kit com colunas

  17. Transcrição reversa

  18. (Nanodrop) (Quebit)

  19. Espectrofotômetro - Nanodrop 260/230 ~1,8 260/230 ~2,0 260nm – DNA/RNA 280nm – proteína, fenol,.. 230nm – contaminantes (carboidratos, fenol,..)

  20. Armazenar? Estoque Uso (diluído) DNA: -20◦C RNA: -80◦C

  21. Enzima de restrição: • Endonucleases produzidas por bactérias para se defender de vírus. • Quebram o DNA em fragmentos menores, não infecciosos. • Reconhecem sítios específicos (sítios de restrição) no genoma e a corta. • São conhecidos mais de 3000 enzimas

  22. Enzima de restrição: tipos de clivagem Fragmentação DNA! Clonagem! Genotipagem! ...

  23. Enzima de restrição: Detecção de SNPs RFPL: Polimorfismos de comprimento do fragmento de restrição • Detecção dos polimorfismos de nucleotídeos únicos (SNPs – singlenucleotidepolymorphisms). • Os primersutilizados na PCR flanqueiam a região que contém, ou não, o sítio de clivagem reconhecido pela enzima de restrição utilizada. • O produto da PCR é posteriormente submetido à ação da enzima de restrição.

  24. Enzima de restrição: como ocorre a clivagem

  25. 2/2 1/2 2/2 2/2 1/1 1/2 1/1 Enzima de restrição: resultado da restrição 3´ CGTAAATCTATACGAGAATTCACGTACGTA5´ 5´ GCATTTAGATATGCTCTTAAGTGCATGCAT3´3´ CGTAAATCTATACGAGTATTCACGTACGTA5´5´ GCATTTAGATATGCTCATAAGTGCATGCAT3´ 2 1 2/2 1/2 1/1