230 likes | 433 Views
DNA Typing. bsapp.com. bsapp.com. DNA strands come from the nucleus or the mitochondria. bsapp.com. DNA Strands. Building block of genetic makeup A complete copy of an individuals entire genome exist in nearly every cell Each persons genome is made up of billions of base pairs
E N D
DNA Typing bsapp.com
DNA strands come from the nucleus or the mitochondria bsapp.com
DNA Strands • Building block of genetic makeup • A complete copy of an individuals entire genome exist in nearly every cell • Each persons genome is made up of billions of base pairs • Most base pairs are “junk” DNA bsapp.com
DNA is made up of chromosomes which contain matching genes called alleles bsapp.com
Base Pairs • Adenine • Thymine • Guanine • Cytosine bsapp.com
Variable Number Tandem Repeaters (VNTR) • Portions of DNA sequences are repeated • These repetitions vary among individuals CACATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATTGC bsapp.com
Forensic DNA Testing • Only one-tenth of a percent of DNA differs from one human to the next • This still leaves millions of bases to analyze for differences bsapp.com
Types of DNA Testing PCR (Polymorphism Chain Reaction) RFLP (Restriction Fragment Length Polymorphism) STR (Short Tandem Repeat) mtDNA (Mitochondrial DNA Analysis) bsapp.com
PCR (Polymorphism Chain Reaction) • Doesn't accomplish DNA typing • Increases the amount of DNA available for typing by producing millions of copies • Use to amplify tiny quantities and degraded samples • Extremely sensitive to contamination bsapp.com
Basic Procedure for Typing bsapp.com
DNA is cut into different size VNTR’s by the use of restriction enzymes bsapp.com
Fragments are placed on a gel plate bsapp.com
The DNA is then transferred from the gel plate and made visible bsapp.com
RFLP (Restriction Fragment Length Polymorphism) • Oldest/Cheapest test • Requires large amounts of non-degraded DNA • Utilizes the longer sequences of VNTR’s bsapp.com
STR (Short Tandem Repeat) or SSR (Simple Sequence Repeats) • Used to evaluate specific regions (loci) of DNA strands • Utilizes shorter stands than VNTR’s • May by used on much smaller, older, and more degraded samples • Usually requires PCR prior to testing bsapp.com
mtDNA(Mitochondrial DNA) • Uses DNA from a cellular organelle called a mitochondrion • Mitochondrial DNA degrades at a much slower rate than nuclear DNA • Allows analysis of older biological samples, such as hair and bones • Not as precise as STR • Extremely expensive and time consuming bsapp.com
Reading DNA Tests bsapp.com