slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Techniques to study complex genetic diseases PowerPoint Presentation
Download Presentation
Techniques to study complex genetic diseases

Loading in 2 Seconds...

play fullscreen
1 / 94

Techniques to study complex genetic diseases - PowerPoint PPT Presentation


  • 159 Views
  • Uploaded on

Techniques to study complex genetic diseases. Dr. Nallur B. Ramachandra Principle Investigator Professor and Coordinator for M.Sc., Genetics Genomics Laboratory, DOS in Zoology University of Mysore Manasagangotri , Mysore – 570 006 nallurbr@gmail.com / nbruom@gmail.com.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Techniques to study complex genetic diseases' - bowen


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

Techniques to study complex genetic diseases

Dr. Nallur B. Ramachandra

Principle Investigator

Professor and Coordinator for M.Sc., Genetics

Genomics Laboratory, DOS in Zoology

University of Mysore

Manasagangotri, Mysore – 570 006

nallurbr@gmail.com /nbruom@gmail.com

slide2

According to WHO

  • 140 million children were born every year
  • 5 million die in the 1st month of life in developing countries
  • 1/6 of the world population is suffering with genetic diseases
slide3

~ 4-6% of all births result in defects

  • 20-30% of all infant deaths - genetic disorders
  • The distressing and disturbing truth in this sad saga is that there is no cure available to these diseases
  • Hence, the prevention of the inheritance of such diseases becomes absolutely essential
slide4

Genetic disorders

  • The problems are enormous
  • Causes physical misery and
  • psychological trauma to the patients and
  • to their family
slide5

Four categories:

  • Mendelian disorders
  • b) Chromosomal disorders
  • c) Multifactorial disorders
  • d) Nontraditional inheritance disorders
  • (www.merck.com/mrkshared/manual)
slide6

Online Mendelian Inheritance in Man (OMIM)

A catalog of human genes and genetic disorders

~15,500 known

how genetic diseases differ from other diseases
How Genetic Diseases Differ from Other Diseases
  • Predict recurrence risk in other family members
  • Predictive testing
  • Genetic variability and diversity
  • Correction of genetic defect may be possible
humans are also very different
Humans are also very different

On average two random people differ at 3 mbp ~1/1000.

A few genes can have a big impact on appearance.

slide10

Gene

DNA

Population

Genome

Individual

Family (pedigree)

Approach -1

Cell

Chromosome

approach 2
Approach - 2
  • Transmission Genetics
  • Pedigree Analysis
  • Cytogenetics
  • Molecular Genetics
  • Population Genetics
slide12

Gene

Genome

DNA Methylation

Epigenome

Transcript

Transcriptome

Protein

Proteome

Approach – 3 Four Levels of Biomarkers

slide13

http://www.who.int/mediacentre/factsheets/fs317/en/index.htmlhttp://www.who.int/mediacentre/factsheets/fs317/en/index.html

slide14

5 most common serious birth defects

Congenital heart defects

Neural tube defects

The hemoglobin disorders

Down syndrome

Glucose-6-phosphate dehydrogenase

deficiency

March of demise birth defect foundation, 2006

analysis
Analysis
  • Prevalence
  • Pedigree
  • Chromosomes
  • Gene isolation
  • Single nucleotide polymorphisms
  • Changes in the protein
  • Whole genome scan
  • Counseling, management & treatment
complex diseases undertaken
Complex diseases undertaken

1) Chromosomal syndromes –DS,TS,KS

2) Congenital Heart diseases

3) Asthma

4) Dyslexia

slide18

Congenital Heart Disease (CHD)

  • Malformation of the heart or the large blood vessels of the heart
  • Constitute 1% of developmental abnormalities
  • Prevalence - 1.01 to 150 / 1000 livebirths
  • Mysore - 11.01/1000 livebirths

Reamon-Buettner et al., 2007 BMC Med Genet.; 8: 38,

Smitha et al.,2006, Indian Journal of Human Genetics, 12,1

slide19

A four chambered heart is necessary for the separation of oxygenated and deoxygenated blood.

Garg, 2006,Cell Mol Life Sci, 63:1141-1148

slide22

Prevalence of pediatric disorders in Mysore

Overall Prevalence = 1-2% live births

slide23

Prevalenceof CHD during 2000-2005 in three major hospitals of Mysore.

Smitha et al., Ind J Hum Genet, 2005

slide25

A

B

I

I

1 2

1 2

II

II

1 2 3 4 7 9

1 2 3 4 5 6 7

5 6

III

1 2 3 4 5 6 7 8

III

1 3 4 5 6

IV

1 2 3 4

2 8

IV

1 2 3

Pedigree of consanguineous marriages between parents of CHD patients:

(A) Uncle-niece marriage and(B) First-cousin marriage

slide26

Parental consanguinity~24%

Smitha et al., Annals Hum Bio, 2006

slide31

Clinical feature of the patient with Isochromosome 18

  • Hurried breathing, nasal discharge,
  • On-and-off fever and constipation
  • Body weight below the 5th percentile for age and sex
  • Short stature
  • Microcephaly
  • Depressed nasal bridge
  • Epicanthal folds
  • Low-set ears
  • High-arched palate, clinodactyly, and
  • Congenital Heart disease
slide32

i(18p)

G-banded chromosomes of congenital heart disease patient with isochromosome 18p [47,XX,+i(18p)]: Metaphase showing the i(18p) (arrow).

Smitha et al., J App Genet, 2006

slide33

18p

i(18p)

18p

FISH plate showing chromosome 18p subtelomeric region on metaphase chromosome of the isochromosome 18p child. FISH probe identifies chromosome 18p (spectrum green),centromeric 18 (spectrum aqua),chromosome 11p (spectrum green) and chromosome 11q (spectrum orange). The labels 18p and arrow denote the 18p of the normal chromosome 18 (white) and isochromosome 18p (yellow) respectively.

slide34

Clinical feature of the patient with trisomy 21

  • low set ears
  • flat occiput
  • depressed nasal bridge
  • mangoloid shunt
  • clinodactyly
  • simian crease
  • nonrestrictive ostium secundum (OS) type of ASD
slide35

21

b

a

c

21

A.

B.

FISH image of the proband [47,XY,+21,t(9;13)(q34.1;q34)]:(A) Trisomy 21 (Spectrum red) and (B) Subtelomeric deletion on chromosome 9q and the translocation of the deleted region on subtelomeric region of chromosome 13q on metaphase chromosomes of the proband. (a) Normal chromosome 9q region (Spectrum red); (b) Chromosome 9 with subtelomeric deletion of 9q; (c) Chromosome 13 with subtelomeric region of chromosome 9 (Spectrum red).

slide36

Clinical feature of the patient -complex translocation

  • Complex CHD :
  • small sized muscular VSD
  • nonrestrictive ASD with OS type and
  • a large side PDA
slide37

A.

B.

G-banded chromosomes of the congenital heart disease patient with complex variant translocation among chromosomes 5, 9 and 13 [t(5;9;13)(q14;p24;q34.1)]: (A) Metaphase showing (i) del9q11 (arrow) and (ii) t(5;9;13)(q14;p24;q34.1), and (B) Karyotype of the above metaphase.

slide38

a

e

b

d

c

FISH image showing the complex variant translocation between chromosomes 5q, 9p and 13q on metaphase chromosomes of the proband [46, XY, t(5;9;13)(q14;p24;q34.1)]:(a) Normal chromosome 5; (b) Abnormal chromosome 5 with part of 5q deleted; (c) Normal chromosome 9; (d) Abnormal chromosome 9 with the deleted part of chromosome 5q;(e) Chromosome 13 with the deleted subtelomeric region of chromosome 9p.

slide39

9

9

G-banded chromosomes of the congenital heart disease patient with inversion in chromosome 9[inv(9)(p11-q13)]: Metaphase showing inv(9)(p11- q13) (arrow).

Smitha et al., Int J Hum Genet, 2007

slide41

Clinical Features: Complex variant

  • Complex CHD small sized muscular VSD (3mm)
  • nonrestrictive ASD with OS type (7mm)
  • a large side PDA (6mm)
  • Anoxia amblyopia
  • Deafness
slide42

M-FISH image of congenital heart disease patient with complex variant translocation chromosomes 5, 9, 11 and13 [t(5;9;11;13)(q14;p24;p15;q33)]

Smitha et al., Int J Hum Genet, 2010

slide45
PROKARYOTIC GENES
  • EUKARYOTIC GENES
  • HUMAN GENES
slide46

GENE LENGTH

Covers a spectrum of sizes 21bp to > 2000kb

microRNA – 11bps - 21bps

tRNA, snRNA genes – smallest 65-75bps

The smallest protein coding gene- 406 bp –histone H4

The longest human gene so far discovereddystrophin gene- 2400 kb with 79 introns

gene isolation strategy
Gene isolation strategy

DNA LIBRARY PROBE

HYBRIDIZATION

PURIFICATION OF POSTIVE CLONE

DNA SEQUENCING & ANALYSIS

CONFIRMATION OF GENE

USE AS UNIQUE MOLECULE / DRUG

positional cloning
Positional cloning
  • Microsatellite markers
  • RFLP markers
  • Chromosome walking
  • Chromosome jumping
p olymerase c hain r eaction
Polymerase Chain Reaction

…invented by Kary Mullis while cruising in a Honda Civic on Highway 128 from San Francisco to Mendocino,

"It was quiet and something just went, Click!"

Kary B. Mullis

Nobel Laureate, 1993

Chemistry

slide53

Embryonic heart development

Bruneau, Nature, 2008

slide57

Classification of SNPs

SNP

Location iSNPcSNPrSNPgSNP

Function nsSNPsSNP

Gene A

Gene B

Exon 1

Exon 2

Exon 3

Exon 1

Exon 2

rSNP

cSNP

gSNP

iSNP

slide58

Why Are SNPs Important?

  • Indicate - Disease predisposition and onset - Drug toxicity - Drug efficacy
  • new drug targets
  • SNPs will enable physicians to personalize therapy
slide59

SNP genotyping

by

massarray analysis

slide60

Principle of the MassARRAY

  • Extension of an oligonucleotide probe over a SNP site in a PCR product, with a mixture of deoxynucleotides and dideoxynucleotides, to produce different size products for each allele of a SNP.
  • The extended products are analyzed by SEQUENOM MALDI-TOF mass spectrometry, and the time-of-flight is proportional to mass, permitting precise determination of the size of products generated, which can be converted into genotype information.
slide62

MassARRAY System (MALDI-TOF)

  • Primer extension reactions designed to generate different sized products
  • Analysis by mass spectrometry

C/T

G/A

dTTP

dGTP

ddCTP

dATP

G/A

Mass in Daltons

Extendable primer

GGACCTGGAGCCCCCACC

5430.5

C analyte

GGACCTGGAGCCCCCACCC

5703.7

Tanalyte

GGACCTGGAGCCCCCACCTC

5976,9.9

slide63

Primer extension mass spectrometry

  • Advantages:
    • accurate
    • automated assay design
    • fast automated data collection
    • multiplexing capacity
  • Disadvantages:
    • expensive instruments, consumables
    • extensive post-PCR processing
slide64

Massarray analysis of

Congenital Heart Disease(CHD)

  • Focusing on four major genes involved in CHD
  • - NKX2.5, GATA4, CRELD1, TFAP2B
  • Analysis of 50 SNPs
  • Targeted the SNPs in direct correlation with genotype and phenotype
softwares
Softwares
  • Accelrys Gene 2.5 (License Pack)
  • Clustal w, Clustal x, Proseq
  • Swiss modeler, Swiss PDB viewer
  • VADAR 3D evaluator
  • Pymol
slide69

3-D models of mutated proteins derived from 9 nsSNPs of zinc finger region of GATA4. Each model was superimposed by control (left side of each image) and mutated protein (right side of each image). Models were done using solution structure of the n-terminal zinc finger of murine GATA-1 (PDB Id: 1gnfA) and also for mutant. Ball and stick representation in both the models showed the side chain structural differences between control and mutated proteins. (a) E216D: In control- Delta Carbon (CD), Epsilon Oxygen (OE1, OE2) and in mutant OD1, OD2. (b) G214S: In control-no changes and in mutant Gamma Carbon (CG), Gamma Oxygen (OG). (c) M223T: In control- CB, CG, Delta Sulphur (SD), CE and in mutant CG2, OG1. (d) R229S: In control- CG, CD, Epsilon Nitrogen (NE), CE2, Zeta Carbon (CZ). NH1, NH2 and in mutant OG. (e) G234S: In control- no changes and in mutant CB, OG. (f) N239D: In control-ND2, OD1 and in mutant OD1, OD2. (g) N239S: In control- CG, ND2, OD1 and in mutant OG. (h) Y244C: In control- CG, CD1, CD2, CE1, CZ, OH and in mutant Gamma Sulphur (SG). (i) N248S: In control- CG, ND2, OD1and in mutant OG.

slide70

Our findings - SNPs in NKX2.5

  • 5 known SNPs
  • one new SNP
  • Found only in CHD patients of Mysore
  • c.608A>G (p.E203G)
  • c.852G>A (p.N226D)

Dinesh et al., New York Science J, 2010

slide71

NKX 2.5

Genomic Size: 3,125 bps;  Exon : 2

Transcript length: 1,585 bps

Translation length: 324 residues

  • Tin (TN) domain (aa 9–19)
  • NK-2-specific domain (aa 214–230)
  • Homeodomain (HD) highly conserved regions: 60 aa
slide72
New NKX2.5 SNP

Heterozygous - c. 896C>A (A240A)

Dinesh et al., Genet Test Mol Bio, 2010

slide73

Our findings - SNPs in GATA4

  • 10 Known SNPs
  • one new SNP
  • SNPs found to manifest Septal defects
      • c.278G>C (G93A)
      • c.1207C>A (L403M)
      • c.1232C>T (A411V)
      • c.1295T>C (L432S)
      • c.1180C>G (P394A)
slide74

GATA4 structure

  • Size: 55,757bps
  • Exons: 7
  • Transcript length: 3,372 bps
  • Translation length: 442 residues

Remon-Buettener et al., BMC Med Genet, 2007

slide75
New GATA4 SNP

Homozygous

c.1180C>G (P394A)

slide77

Microarray Principle

Analyse Gene (mRNA) or protein expression through large scale non-radioactive northern and southern hybridization analysis.

Essentially fluorescent based (Cy3, Cy5, Alexa) high throughput Northern blot analysis.

Allows expression analysis of about 30,000 genes in one experiment.

slide78

Types of DNA Microarrays

Short (20-25bp) and Long (30-70bp) Oligo arrays.

cDNA arrays printed on Glass (500-1000bp).

Genomic or EST Arrays generated by DNA amplification method.

slide80

(cDNA, Genomic DNA or protein)

1.RT PCR

2.RNA amplif.

3.Random

labeling

Scan

Combine Equal

amounts

Of Cy3 and Cy5

Hybridize on micro array

Analyze

arrays target hybridisation
Arrays – Target Hybridisation

Hybridizing arrays are of two varieties;

1. Wells 2.Beads

slide82

LOD Score

cM (recombinant distance)

Genomic Screen[1100 markers  5 cM]

LOD = 2.1

LOD = 3.5

slide83

LOD Score analysis:

Multipoint LOD = 3.5

LOD Score

cM (recombinant distance)

slide84
Isolation and screening for Indian specific gene for Dyslexia by using Microarray whole genome scan
slide89

What Next???

  • Pharmacogenomics
  • Counsel the affected families
  • prevention
  • management
  • treatment
slide90

Human as a model system

  • Size
  • Variation
  • More clinical material
  • Knowledge on human biology and genome
  • Modern techniques

Limitations -

Long generation time

Experimental mating is not possible

Willingness

slide91

RESEARCH COLLABORATORS

Research Fellows:Dr. Smitha Ramegowda

Ms. Kusuma L.

Mr. Dinesh S. M.

IISc, Bangalore:Dr. Arun Kumar

Pediatricians, Mysore:Dr. B. Krishnamurthy

Dr. M. R. Savitha

Dr. D. Narayanappa

Dr. S. N. Prashanth

Dr. Prasad Karat

Dr. H. Abbas

Dr. P.A. Mahesh

NIRRH, Mumbai:Dr. Zarine Patel

Mr. Harsh Gawde

slide92

ACKNOWLEDGMENTS

CSIR, New Delhi

Patients, families participated in this study

Doctors and PG students for their kind support

Chairman, DOS in Zoology, Univ. of Mysore

Prof. H. A. Ranganath for his encouragement