480 likes | 634 Views
Fragment Assembly. Given N reads… Where N ~ 30 million… We need to use a linear-time algorithm. Steps to Assemble a Genome. Some Terminology read a 500-900 long word that comes out of sequencer mate pair a pair of reads from two ends of the same insert fragment
E N D
Fragment Assembly Given N reads… Where N ~ 30 million… We need to use a linear-time algorithm
Steps to Assemble a Genome Some Terminology read a 500-900 long word that comes out of sequencer mate pair a pair of reads from two ends of the same insert fragment contig a contiguous sequence formed by several overlapping reads with no gaps supercontig an ordered and oriented set (scaffold) of contigs, usually by mate pairs consensus sequence derived from the sequene multiple alignment of reads in a contig 1. Find overlapping reads 2. Merge some “good” pairs of reads into longer contigs 3. Link contigs to form supercontigs 4. Derive consensus sequence ..ACGATTACAATAGGTT..
T GA TACA | || || TAGA TAGT 1. Find Overlapping Reads • Find pairs of reads sharing a k-mer, k ~ 24 • Extend to full alignment – throw away if not >98% similar TAGATTACACAGATTAC ||||||||||||||||| TAGATTACACAGATTAC • Caveat: repeats • A k-mer that occurs N times, causes O(N2) read/read comparisons • ALU k-mers could cause up to 1,000,0002 comparisons • Solution: • Discard all k-mers that occur “too often” • Set cutoff to balance sensitivity/speed tradeoff, according to genome at hand and computing resources available
1. Find Overlapping Reads • Correcterrors using multiple alignment TAGATTACACAGATTACTGA TAGATTACACAGATTACTGA TAGATTACACAGATTACTGA TAGATTACACAGATTACTGA TAGATTACACAGATTATTGA TAG-TTACACAGATTATTGA TAGATTACACAGATTACTGA TAGATTACACAGATTACTGA TAG-TTACACAGATTACTGA TAG-TTACACAGATTATTGA insert A correlated errors— probably caused by repeats disentangle overlaps replace T with C TAGATTACACAGATTACTGA TAGATTACACAGATTACTGA TAGATTACACAGATTACTGA In practice, error correction removes up to 98% of the errors TAG-TTACACAGATTATTGA TAG-TTACACAGATTATTGA
2. Merge Reads into Contigs • Overlap graph: • Nodes: reads r1…..rn • Edges: overlaps (ri, rj, shift, orientation, score) Reads that come from two regions of the genome (blue and red) that contain the same repeat Note: of course, we don’t know the “color” of these nodes
Overlap graph after forming contigs Unitigs: Gene Myers, 95
Repeats, errors, and contig lengths • Repeats shorter than read length are easily resolved • Read that spans across a repeat disambiguates order of flanking regions • Repeats with more base pair diffs than sequencing error rate are OK • We throw overlaps between two reads in different copies of the repeat • To make the genome appear less repetitive, try to: • Increase read length • Decrease sequencing error rate Role of error correction: Discards up to 98% of single-letter sequencing errors decreases error rate decreases effective repeat content increases contig length
3. Link Contigs into Supercontigs Normal density Too dense Overcollapsed Inconsistent links Overcollapsed?
3. Link Contigs into Supercontigs Find all links between unique contigs Connect contigs incrementally, if 2 links supercontig (aka scaffold)
3. Link Contigs into Supercontigs Fill gaps in supercontigs with paths of repeat contigs
4. Derive Consensus Sequence TAGATTACACAGATTACTGA TTGATGGCGTAA CTA Derive multiple alignment from pairwise read alignments TAGATTACACAGATTACTGACTTGATGGCGTAAACTA TAG TTACACAGATTATTGACTTCATGGCGTAA CTA TAGATTACACAGATTACTGACTTGATGGCGTAA CTA TAGATTACACAGATTACTGACTTGATGGGGTAA CTA TAGATTACACAGATTACTGACTTGATGGCGTAA CTA Derive each consensus base by weighted voting (Alternative: take maximum-quality letter)
Some Assemblers • PHRAP • Early assembler, widely used, good model of read errors • Overlap O(n2) layout (no mate pairs) consensus • Celera • First assembler to handle large genomes (fly, human, mouse) • Overlap layout consensus • Arachne • Public assembler (mouse, several fungi) • Overlap layout consensus • Phusion • Overlap clustering PHRAP assemblage consensus • Euler • Indexing Euler graph layout by picking paths consensus
Quality of assemblies Celera’s assemblies of human and mouse
Quality of assemblies—mouse Terminology:N50 contig length If we sort contigs from largest to smallest, and start Covering the genome in that order, N50 is the length Of the contig that just covers the 50th percentile.
History of WGA 1997 • 1982: -virus, 48,502 bp • 1995: h-influenzae, 1 Mbp • 2000: fly, 100 Mbp • 2001 – present • human (3Gbp), mouse (2.5Gbp), rat*, chicken, dog, chimpanzee, several fungal genomes Let’s sequence the human genome with the shotgun strategy That is impossible, and a bad idea anyway Phil Green Gene Myers
Genomes Sequenced • http://www.genome.gov/10002154
Evolution at the DNA level Deletion Mutation …ACGGTGCAGTTACCA… SEQUENCE EDITS …AC----CAGTCCACCA… REARRANGEMENTS Inversion Translocation Duplication
Protein Phylogenies • Proteins evolve by both duplication and species divergence
Orthology and Paralogy Yeast Orthologs:Derived by speciation Paralogs: Everything else HA1 Human HA2 Human WA Worm HB Human WB Worm
Definition • Given N sequences x1, x2,…, xN: • Insert gaps (-) in each sequence xi, such that • All sequences have the same length L • Score of the global map is maximum • A faint similarity between two sequences becomes significant if present in many • Multiple alignments reveal elements that are conserved among a class of organisms and therefore important in their common biology • The patterns of conservation can help us tell function of the element
Scoring Function: Sum Of Pairs Definition:Induced pairwise alignment A pairwise alignment induced by the multiple alignment Example: x: AC-GCGG-C y: AC-GC-GAG z: GCCGC-GAG Induces: x: ACGCGG-C; x: AC-GCGG-C; y: AC-GCGAG y: ACGC-GAC; z: GCCGC-GAG; z: GCCGCGAG
Sum Of Pairs (cont’d) • Heuristic way to incorporate evolution tree: Human Mouse Duck Chicken • Weighted SOP: • S(m) = k<l wkl s(mk, ml)
A Profile Representation • Given a multiple alignment M = m1…mn • Replace each column mi with profile entry pi • Frequency of each letter in • # gaps • Optional: # gap openings, extensions, closings • Can think of this as a “likelihood” of each letter in each position - A G G C T A T C A C C T G T A G – C T A C C A - - - G C A G – C T A C C A - - - G C A G – C T A T C A C – G G C A G – C T A T C G C – G G A 1 1 .8 C .6 1 .4 1 .6 .2 G 1 .2 .2 .4 1 T .2 1 .6 .2 - .2 .8 .4 .8 .4
Multiple Sequence Alignments Algorithms
Multidimensional DP Generalization of Needleman-Wunsh: S(m) = i S(mi) (sum of column scores) F(i1,i2,…,iN): Optimal alignment up to (i1, …, iN) F(i1,i2,…,iN) = max(all neighbors of cube)(F(nbr)+S(nbr))
Multidimensional DP • Example: in 3D (three sequences): • 7 neighbors/cell F(i,j,k) = max{ F(i – 1, j – 1, k – 1) + S(xi, xj, xk), F(i – 1, j – 1, k ) + S(xi, xj, - ), F(i – 1, j , k – 1) + S(xi, -, xk), F(i – 1, j , k ) + S(xi, -, - ), F(i , j – 1, k – 1) + S( -, xj, xk), F(i , j – 1, k ) + S( -, xj, - ), F(i , j , k – 1) + S( -, -, xk) }
Multidimensional DP Running Time: • Size of matrix: LN; Where L = length of each sequence N = number of sequences • Neighbors/cell: 2N – 1 Therefore………………………… O(2N LN)
Multidimensional DP • How do gap states generalize? • VERY badly! • Require 2N – 1 states, one per combination of gapped/ungapped sequences • Running time: O(2N 2N LN) = O(4N LN) Running Time: • Size of matrix: LN; Where L = length of each sequence N = number of sequences • Neighbors/cell: 2N – 1 Therefore………………………… O(2N LN) Y YZ XY XYZ Z X XZ
Progressive Alignment x • When evolutionary tree is known: • Align closest first, in the order of the tree • In each step, align two sequences x, y, or profiles px, py, to generate a new alignment with associated profile presult Weighted version: • Tree edges have weights, proportional to the divergence in that edge • New profile is a weighted average of two old profiles pxy y z pxyzw pzw w
Progressive Alignment x • When evolutionary tree is known: • Align closest first, in the order of the tree • In each step, align two sequences x, y, or profiles px, py, to generate a new alignment with associated profile presult Weighted version: • Tree edges have weights, proportional to the divergence in that edge • New profile is a weighted average of two old profiles y Example Profile: (A, C, G, T, -) px = (0.8, 0.2, 0, 0, 0) py = (0.6, 0, 0, 0, 0.4) s(px, py) = 0.8*0.6*s(A, A) + 0.2*0.6*s(C, A) + 0.8*0.4*s(A, -) + 0.2*0.4*s(C, -) Result:pxy= (0.7, 0.1, 0, 0, 0.2) s(px, -) = 0.8*1.0*s(A, -) + 0.2*1.0*s(C, -) Result:px-= (0.4, 0.1, 0, 0, 0.5) z w
Progressive Alignment x • When evolutionary tree is unknown: • Perform all pairwise alignments • Define distance matrix D, where D(x, y) is a measure of evolutionary distance, based on pairwise alignment • Construct a tree (UPGMA / Neighbor Joining / Other methods) • Align on the tree y ? z w
Heuristics to improve alignments • Iterative refinement schemes • A*-based search • Consistency • Simulated Annealing • …
Iterative Refinement One problem of progressive alignment: • Initial alignments are “frozen” even when new evidence comes Example: x: GAAGTT y: GAC-TT z: GAACTG w: GTACTG Frozen! Now clear correct y = GA-CTT
allow y to vary x,z fixed projection Iterative Refinement Algorithm (Barton-Stenberg): • For j = 1 to N, Remove xj, and realign to x1…xj-1xj+1…xN • Repeat 4 until convergence z x y
Iterative Refinement Example: align (x,y), (z,w), (xy, zw): x: GAAGTTA y: GAC-TTA z: GAACTGA w: GTACTGA After realigning y: x: GAAGTTA y: G-ACTTA + 3 matches z: GAACTGA w: GTACTGA
Iterative Refinement Example not handled well: x: GAAGTTA y1: GAC-TTA y2: GAC-TTA y3: GAC-TTA z: GAACTGA w: GTACTGA • Realigning any single yi changes nothing
Consistency zk z xi x y yj yj’
Consistency zk z Basic method for applying consistency • Compute all pairs of alignments xy, xz, yz, … • When aligning x, y during progressive alignment, • For each (xi, yj), let s(xi, yj) = function_of(xi, yj, axz, ayz) • Align x and y with DP using the modified s(.,.) function xi x y yj yj’
Real-world protein aligners • MUSCLE • High throughput • One of the best in accuracy • ProbCons • High accuracy • Reasonable speed
MUSCLE at a glance • Fast measurement of all pairwise distances between sequences • DDRAFT(x, y) defined in terms of # common k-mers (k~3) – O(N2 L logL) time • Build tree TDRAFT based on those distances, with UPGMA • Progressive alignment over TDRAFT, resulting in multiple alignment MDRAFT • Only perform alignment steps for the parts of the tree that have changed • Measure new Kimura-based distances D(x, y) based on MDRAFT • Build tree T based on D • Progressive alignment over T, to build M • Iterative refinement; for many rounds, do: • Tree Partitioning: Split M on one branch and realign the two resulting profiles • If new alignment M’ has better sum-of-pairs score than previous one, accept
PROBCONS at a glance • Computation of all posterior matrices Mxy : Mxy(i, j) = Prob(xi ~ yj), using a HMM • Re-estimation of posterior matrices M’xy with probabilistic consistency • M’xy(i, j) = 1/N sequence zk Mxz(i, k) Myz (j, k); M’xy = Avgz(MxzMzy) • Compute for every pair x, y, the maximum expected accuracy alignment • Axy: alignment that maximizes aligned (i, j) in AM’xy(i, j) • Define E(x, y) = aligned (i, j) in AxyM’xy(i, j) • Build tree T with hierarchical clustering using similarity measure E(x, y) • Progressive alignment on T to maximize E(.,.) • Iterative refinement; for many rounds, do: • Randomized Partitioning: Split sequences in M in two subsets by flipping a coin for each sequence and realign the two resulting profiles
Some Resources Genome Resources Annotation and alignment genome browser at UCSC http://genome.ucsc.edu/cgi-bin/hgGateway Specialized VISTA alignment browser at LBNL http://pipeline.lbl.gov/cgi-bin/gateway2 ABC—Nice Stanford tool for browsing alignments http://encode.stanford.edu/~asimenos/ABC/ Protein Multiple Aligners http://www.ebi.ac.uk/clustalw/ CLUSTALW – most widely used http://phylogenomics.berkeley.edu/cgi-bin/muscle/input_muscle.py MUSCLE – most scalable http://probcons.stanford.edu/ PROBCONS – most accurate