1 / 31

CH. 12.3 : DNA, RNA, and Protein

CH. 12.3 : DNA, RNA, and Protein. Section Objectives: Relate the concept of the gene to the sequence of nucleotides in DNA. Sequence the steps involved in protein synthesis. Explain the different types of RNA involved in protein synthesis. Genes and Proteins.

bianca-richmond
Download Presentation

CH. 12.3 : DNA, RNA, and Protein

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. CH. 12.3 : DNA, RNA, and Protein Section Objectives: Relate the concept of the gene to the sequence of nucleotides in DNA. Sequence the steps involved in protein synthesis. Explain the different types of RNA involved in protein synthesis

  2. Genes and Proteins • The sequence of nucleotides in DNA contain information. • This information is put to work through the production of proteins. • Proteins fold into complex, three- dimensional shapes to become key cell structures and regulators of cell functions. • Thus, by encoding the instructions for making proteins, DNA controls cells.

  3. What are Genes • You learned earlier that proteins are polymers of amino acids. • The sequence of nucleotides in your DNA is a gene that contains the information for assembling the string of amino acids that make up a single protein. (instructions to make a protein) • Proteins control an organism: • Enzymes, Steroids, Structural Proteins etc.. Are all made from the sequence of letters in your DNA • Proteins are polymers made of amino acid monomers • Where are proteins made? • Ribosomes!!

  4. Cell organization • Remember: • DNA is in the nucleus • DNA contains genes = instructions for making proteins • Cells want to keep DNA in the nucleus where it is protected • “locked in the vault” • How does the code for a protein get to a ribosome if the DNA can’t leave the nucleus?

  5. Passing on DNA information: need RNA • RNA like DNA, is a nucleic acid • RNAstructure differs from DNA structure in three ways. • 1. Has ribose sugar instead ofdeoxyribose(DNA) • 2. Replaces thymine (T) with uracil (U) • 3. Single strandedas opposed to double strandedDNA Nitrogenous base(A, G, C, or U) Phosphategroup Uracil (U) Sugar(ribose)

  6. RNA • RNA has a different function than DNA • Whereas DNA provides the instructions for protein synthesis, RNA does the actual work of protein synthesis. • RNA Function: takes from DNA the instructions on how the protein should be assembled, then—amino acid by amino acid—RNA’s assemble the protein.

  7. Types of RNA 3 types of RNA • 1. Messenger RNA (mRNA), single, uncoiled strand which brings instructions from DNA in the nucleus to the site of protein synthesis (Ribosome). • 2. Ribosomal RNA (rRNA), globular form, makes up the ribosome –the construction site of proteins (site of protein synthesis); binds to the mRNA and uses the instructions to assemble the amino acids in the correct order. • 3. Transfer RNA (tRNA) single, folded strand that delivers the proper amino acid to the site at the right time. Has a specific anticodon that is complementary to the sequence on the mRNA.

  8. From gene to protein protein transcription translation

  9. Protein Synthesis: 2 step process1. Transcription 2. translation 1.Transcription: DNA -> mRNA • In the nucleus, enzymes make an RNA copy of a portion of a DNA strand The main difference between transcription and DNA replication is that transcription results in the formation of one single-stranded RNA molecule rather than a double-stranded DNA molecule. 2. Translation: mRNA -> Protein • process of converting the information in a sequence of nitrogenous bases in mRNA into a sequence of amino acids in protein

  10. Transcription • Making mRNA from DNA • DNA strand is the template (pattern) • match bases • U : A • G : C • Enzyme • RNA polymerase- splits the DNA, then attaches a complementary strand of RNA. Afterwards the DNA reattaches

  11. Matching bases of DNA & RNA • Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

  12. Matching bases of DNA & RNA • Double stranded DNA unzips • RNA polymerase attaches at a promoter which is a region of DNA that signals the start of a gene. T G G T A C A G C T A G T C A T C G T A C C G T

  13. RNA polymerase Matching bases of DNA & RNA A C U • Match complimentary RNA bases to DNA bases on one of the DNA strands (T is replaced with U) G A G G U C U G C A C A U A G A C U A G C C A T G G T A C A G C T A G T C A T C G T A C C G T

  14. Matching bases of DNA & RNA • U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA

  15. RNA Processing • Not all the nucleotides in the DNA of eukaryotic cells carry instructions—orcode—for making proteins. • Genes usually contain many long non-coding nucleotide sequences, called introns, that are scattered among the coding sequences. • Regions that contain information are called exons because they are expressed. • When mRNA is transcribed from DNA, bothintrons and exons are copied. • Theintrons must be removed from the mRNA before it can function to make a protein. • Enzymes in the nucleus cut out theintron segments and paste the mRNA back together. • The mRNA then leaves the nucleus and travels to the ribosome.

  16. RNA Processing:simplified • Noncoding segments called introns are spliced out ( coding segment = exons)

  17. Translation: From mRNA to Protein • takes place at the ribosomes in the cytoplasm. Involves 3 types of RNA 1. Messenger RNA (mRNA) =carries the blueprint for construction of a protein 2. Ribosomal RNA (rRNA) = the Ribosome the construction site where the protein is made 3. Transfer RNA (tRNA) = the molecule delivering the proper amino acid to the site at the right time

  18. Genetic information written in codonsis translated into amino acid sequences • Transfer of DNA to mRNA uses “language” of nucleotides • Letters: nitrogen bases of nucleotides (A,T,G,C) • Words: codons : triplets of bases ( ex. AGC)- groups of 3 • Sentences: polypeptide chain • The codons in a gene specify the amino acid sequence of a polypeptide

  19. The Genetic Code • The nucleotide sequence transcribed from DNA to a strand of messenger RNA acts as a genetic message, the complete information for the building of a protein.. • Virtually all organisms share the same genetic code

  20. Transfer RNA molecules serve as interpreters during translation • In the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptide • The process is aided by transfer RNAs • Each tRNA molecule has a triplet anticodon on one end and an amino acid attachment site on the other • Anticodon base pairs with codon of mRNA

  21. mRNA A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa aa aa aa aa aa How does mRNA code for proteins • mRNA leaves nucleus • mRNA goes to ribosomes in cytoplasm • Proteins built from instructions on mRNA How?

  22. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Amino acids/ protein MetArgValAsnAlaCysAla ? How does mRNA code for proteins? How can you code for 20 amino acids withonly 4 DNA bases (A,U,G,C)?

  23. TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in tripletscalled codons • Codon = block of 3 mRNA bases

  24. The Genetic code • For ALL life! • support for a common origin for all life • Code has duplicates • several codons for each amino acid • This “wiggle room” is mutation insurance! • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

  25. How are the codons matched to amino acids? • The tRNA molecule has a complementary codon to the mRNA called an anticodon • There is a specific tRNA for each amino acid

  26. ribosome mRNA A C C A U G U C G A U C A G U A G C A U G G C A U A C G G U tRNA tRNA A G aa U A G tRNA aa aa aa tRNA aa aa mRNA to protein = Translation • The working instructions  mRNA • The reader  ribosome • The transporter  transfer RNA (tRNA) C

  27. From gene to protein protein Transcription DNA-> RNA Translation RNA-> protein

  28. DNA – TAC CAA GGA AGT GCG ATA CAT CGT AGC GGT • mRNA- • A.A. –

More Related