1 / 23

Barcoding Jellyfish Species: Exploring Relationships and Differences

Dr. David Pontin discusses the use of DNA barcoding in identifying jellyfish species, focusing on the mitochondrial gene cytochrome c oxidase I (COI). This research explores species delineation, cryptic species complexes, and hybridization within Physalia species, particularly the bluebottle jellyfish. The study highlights challenges in species identification and the importance of integrating molecular data with oceanographic variables to predict jellyfish occurrences in New Zealand. The findings underscore the complexity of jellyfish taxonomy and its implications for marine biodiversity.

betty
Download Presentation

Barcoding Jellyfish Species: Exploring Relationships and Differences

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Finding relationships and differences by bar-coding jellyfish species Dr. David Pontin

  2. A beginning

  3. Barcodes • Barcode: A short series of vertical bars representing the digits 0-9, commonly used for product identification. • DNA Barcode: A short length of DNA that is able to differentiate between species. caggggcacgaatcagttaccaaatcctccaattagaactggcattacaaggaaaaagatcataacaaatgcatgagcagttactataacattatagagatgatcatctccaaacatggtaccaggtcctgacaa

  4. Looking for DNA Barcodes • Mitochondrial DNA vs. Nuclear DNA • “fast evolving” tips only of interest • Must work in >90% of examples • 650 bp length of Mitochondrial DNA called cytochrome c oxidase I or COI

  5. DNA Barcoding today • Formally Described Species :72,144 • Total Barcode Records 871,435 • Barcode of life project caggggcacgaatcagttaccaaatcctccaattagaactggcattacaaggaaaaagatcataacaaatgcatgagcagttactataacattatagagatgatcatctccaaacatggtaccaggtcctgacaa

  6. A bit of controversy • What constitutes a species? • Rule of thumb for insects is 2% divergence (13bp) • Cryptic species/species complexes • DNA vs. morphology • COI doesn't work for everything (plants) • Is one gene enough?

  7. Physalia (Siphonophora) Completely pelagic Taxonomically ambiguous Abundant around New Zealand Passive surface dispersal

  8. PhD. goals • Identify the species • Identify important oceanographic variables that influence bluebottle occurrence • Predict bluebottle occurrence

  9. Portuguese Man o War Physalia physalis The Bluebottle Physalia utriculus

  10. Bluebottle locations 54 specimens 13 locations COI and ITS sequenced

  11. Likelihood trees ITS COI Physalia physalis

  12. Genetic linkages (COI)

  13. Hybridisation? • Two explanations for the ones that “jumped ship” • Hybridisation • Ancestral polymorphisum • More likely to be hybridisation • Range overlap • Broad cast spawning • Reported in the Anthozoa

  14. Western Australia 1 • Doesn't fit any clan • If removed, green clan is well supported • What’s going on?

  15. Conflict Tree 2 Tree 1 A A B C 60% 40% B D C D

  16. Achieving goals (or not) • We still don’t know what species of bluebottle occurs in New Zealand • But it is a species complex needing a global review • COI was a good choice but results heighted the need for other markers with “difficult” species

  17. Hypothesised movement of Physalia

  18. Hypothesised blooming zone

  19. Synergy • Both techniques confirm the existence of two circulatory systems • Molecular data shows what’s there and the models suggest how it got there • Methods allow potential blooming areas to be inferred so that other evidence can be examined in a directed manner • Not possible if methods are considered independently

  20. Wider Picture • How many other jellyfish species could be the same?What does that mean for New Zealand's marine biodiversity? • Population identification has several usages • Pest control: resistance • Population linkages

More Related