Supplementary Figure 9: Zanotto et al

Sep 15, 2014

10 likes | 87 Views

0 100 200 300 400 500 bp. Mrps12. I II III IV. Relative expression (a.u.) 100 0 100 200 300. Sarsm. WT Mu4 Mu5 NFAT MYB CREBB Mu6 Mu13 Mu1 GATA Mu2 Mu7. (a). Sarsm Mrps12. (b).

Share Presentation

Embed Code

Link

bandele

Download Presentation

Supplementary Figure 9: Zanotto et al

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

0 100 200 300 400 500 bp Mrps12 I II III IV Relative expression (a.u.) 100 0 100 200 300 Sarsm WT Mu4 Mu5 NFAT MYB CREBB Mu6 Mu13 Mu1 GATA Mu2 Mu7 (a) Sarsm Mrps12 (b) 1 Mu4 AP18 Mu5 NFAT 120 ctctatttggaaacaagaatctactcatcatggacgagcccatcagacgcgcaaggagatttttctcacaggcttcagaatcccttccaatgagagaaatggaactcagctagaatctga MYB CREBB AP158 NRF-2 Mu6 240 atttgtcccatcgagatccttgtcccgtcccttcagtagagcaggaaagatctagcccatcactaaggaggaaccccgtctggggctggaggtaggggttggcgtgtttgtctcagtgtt Mu13 GATA Mu2 Mu3 360 aggttggtgaggtggaagcagtttcttgtgatccagatctctcctctctcctcagtttccccttccagtatccgggcaagggcggttgagtattctggtgcctactcagaaggagacagg Mu1 -> aat Mu7 480 tattgctcctagattttctgttttagaggagattctagaaggctctgagagtgggtttctggtcccaacctcctttctgaatgtcttctctcctaatacagggacgctgcagtctgcgag Supplementary Figure 9: Zanotto et al

Figure 2.1 Song dialects in white-crowned sparrows

Figure 2.1 Song dialects in white-crowned sparrows Soha et al. 2004 Figure 2.2 Hearing is critically important for song learning in the zebra finch Figure 2.3 Song learning hypothesis based on laboratory experiments with white-crowned sparrows

1.56k views • 29 slides

Chapter 9

Chapter 9. Counters. Asynchronous Counter Operation. Figure 9--1 A 2-bit asynchronous binary counter. . Figure 9--2 Timing diagram for the counter of Figure 9-1. As in previous chapters, output waveforms are shown in green.

2.39k views • 74 slides

Supplementary Training Modules on Good Manufacturing Practice

Water for Pharmaceutical Use Part 2: Water purification engineering Presented by Dr. Errol Allcoc 30 June 2005, Pretoria, South Africa Errol.Allcock@microsep.co.za 083-459 6267. Supplementary Training Modules on Good Manufacturing Practice. Objectives

1.16k views • 36 slides

GRASP Graded Repetitive Arm Supplementary Program

GRASP Graded Repetitive Arm Supplementary Program. Janice Eng, PhD, BSc (PT/OT) Dept of Physical Therapy University of BC GF Strong Rehab Centre. What is GRASP?. GRASP is an arm and hand exercise program for people with stroke It can be undertaken by the patient on their own as homework

1.3k views • 13 slides

Fiona Brown Aarti Gulyani Stephen McDonald Kylie Hurst

CHAPTER 6. PERITONEAL DIALYSIS. Fiona Brown Aarti Gulyani Stephen McDonald Kylie Hurst. 2012 Annual Report—35th Edition. Figure 6.4. Figure 6.5. Figure 6.6. Figure 6.7. Figure 6.9. Figure 6.10. Figure 6.11. Figure 6.12. Figure 6.13. Figure 6.14. Figure 6.15. Figure 6.16.

1.1k views • 85 slides

Figure 35.0 The effect of submersion in water on leaf development in Cabomba

Figure 35.0 The effect of submersion in water on leaf development in Cabomba. Figure 35.0x The effect of wind on plant form in fir trees. Figure 35.2 Morphology of a flowering plant: an overview. Figure 35.1 A comparison of monocots and dicots. Figure 35.3 Radish root hairs.

1.57k views • 95 slides

HAEMODIALYSIS

CHAPTER 5. HAEMODIALYSIS. Figure 5.2. Figure 5.4. Figure 5.6. Figure 5.7. Figure 5.8. Figure 5.9. Figure 5.12. Figure 5.13. Figure 5.15. Figure 5.16. Figure 5.17. Figure 5.18. Figure 5.19. Figure 5.20. Figure 5.25. Figure 5.26. Figure 5.27. Figure 5.28. Figure 5.30.

1.36k views • 116 slides

Electronic Supplementary Information

Electronic Supplementary Information. Synthesis and evaluation of fluorescent cap analogues for mRNA labelling Marcin Ziemniak a , Mariusz Szabelski b , Maciej Lukaszewicz a , Anna Nowicka a , Edward Darzynkiewicz a , Robert E. Rhoads c , Zbigniew Wieczorek b , Jacek Jemielity a , d *.

763 views • 62 slides

Figure and Form

Figure and Form. Homework: Design a title page for your new project. Include – The title ‘Figure and Form’ Images of the figure in any medium , e.g. collage, coloured pencil, watercolour etc. Art Club is every Tuesday and Wednesday between 3pm and 4pm. Project Scenario.

1.04k views • 87 slides

Figure 5.5 The human skeleton.

Figure 5.5 The human skeleton. Figure 5.5 The human skeleton. Figure 5.10 Bones of the right side of the pectoral girdle and the right arm and hand. Figure 5.11 Bones of the pelvic girdle and the left leg and foot. Figure 7.24 The pectoral girdle and clavicle. Acromio- clavicular

1.88k views • 42 slides

Philip Clayton

CHAPTER 5. HAEMODIALYSIS. CHAPTER 9. KIDNEY DONATION. Philip Clayton. 2013 Annual Report - 36th Edition. Figure 5.2. Figure 5.2. Figure 5.4. Figure 5.6. Figure 5.7. Figure 5.8. Figure 5.9. Figure 5.12. Figure 5.13. Figure 5.15. Figure 5.16. Figure 5.17. Figure 5.18. Figure 5.19.

1.5k views • 118 slides

Cardiac Muscle

Cardiac Muscle. Figure 1.02. The cardiac cycle in terms of time. Figure 1.02B. Left heart pressures during one cardiac cycle. Figure 1.02C. Ventricular blood volume during one cardiac cycle. Figure 1.02D. Aortic blood flow during one complete cardiac cycle.

1.7k views • 124 slides

Figure 19-1a

Figure 19-1a. Figure 19-1b. Figure 19-1c. Figure 19-1d – e. Figure 19-1d. Figure 19-1e. Figure 19-1f. Figure 19-1g. Figure 19-1h. Figure 19-1i. Figure 19-1j. Figure 19-2. Table 19-1. Figure 19-3. Figure 19-4 - Overview. Figure 19-4a. Figure 19-4b. Figure 19-4c. Figure 19-4d.

766 views • 66 slides

Figure 50.0x Earth from the moon

Figure 50.0x Earth from the moon. Figure 50.1 Distribution and abundance of the red kangaroo in Australia, based on aerial surveys. Figure 50.x1 Patterns of distribution in the biosphere. Figure 50.2 Sample questions at different levels of ecology. Figure 50.4 Biogeographic realms.

1.85k views • 164 slides

Philip Clayton

CHAPTER 6. PERITONEAL DIALYSIS. CHAPTER 9. KIDNEY DONATION. Philip Clayton. 2013 Annual Report - 36th Edition. Figure 6.2a. Figure 6.2b. Figure 6.4. Figure 6.5. Figure 6.6. Figure 6.7. Figure 6.9. Figure 6.10. Figure 6.11. Figure 6.13. Figure 6.14. Figure 6.17. Figure 6.18.

1.12k views • 82 slides

La communication nerveuse

Biorégulation humaine. La communication nerveuse. Figure 48.1. nerfs. encéphale et moelle épinière. Les cellules fonctionnelles du système nerveux sont les neurones. structures réceptrices. structure conductrice. structures sécrétrices. Figure 48.2. Figure 48.4.

2.36k views • 36 slides

TCP/IP

TCP/IP. Figure 24-1. An Internet According to TCP/IP. Figure 24-2. TCP/IP and the OSI Model. Comparison between OSI and TCP/IP. Figure 24-3. IP Packet. Figure 24-4. Internet Address. Figure 24-5. Internet Classes. Figure 24-6. IP Addresses in Decimal Notation. Figure 24-7.

811 views • 63 slides

Figure 7.0 Fluorescent stain of cell

Figure 7.0 Fluorescent stain of cell. Figure 7.1 The size range of cells. Table 7.1 Different Types of Light Microscopy: A Comparison. Figure 7.2 Electron micrographs. Figure 7.3 Cell fractionation. Figure 7.4 A prokaryotic cell. Figure 7.4x1 Bacillus polymyxa.

877 views • 66 slides

Chapter 6 Opener

Chapter 6 Opener. Figure 6.1 The Concept of Coupling Reactions. Figure 6.1 The Concept of Coupling Reactions. Figure 6.2 ATP. Figure 6.2 ATP. In-Text Art, Ch. 6, p. 102 (1). Figure 6.3 Oxidation, Reduction, and Energy. In-Text Art, Ch. 6, p. 102 (2). In-Text Art, Ch. 6, p. 102 (2).

778 views • 64 slides

The World of Plant Classification

The World of Plant Classification. An Unusual Angiosperm. Table 29.1 Ten Phyla of Extant Plants. Figure 29.1 Some highlights of plant evolution. Figure 29.6 Alternation of generations: a generalized scheme. Figure 30.1 Three variations on gametophyte/sporophyte relationships.

1.05k views • 77 slides

actual

actual. forecast. Figure 1. Total energy production in Alberta. Hydro, wind, and other renewables. NGLs. Coalbed methane. Conventional natural gas. Mined and in situ bitumen. Conventional heavy oil. Conventional L&M oil. Coal. Figure 2. Figure 3. same as 3.23.

1.43k views • 121 slides

Chapter 5

Chapter 5. Integration. 5.1. Approximating Areas under Curves. Figure 5.1. Figure 5.2. Figure 5.3. Figure 5.4 (a). Figure 5.4 (b). Figure 5.4 (c). Figure 5.5. Table 5.1. Figure 5.6. Figure 5.7. Figure 5.8. Figure 5.9. Figure 5.10. Figure 5.11. Figure 5.12. Figure 5.13.

1.26k views • 89 slides

More Related