Biologia Molecular - PowerPoint PPT Presentation

biologia molecular n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Biologia Molecular PowerPoint Presentation
Download Presentation
Biologia Molecular

play fullscreen
1 / 69
Biologia Molecular
285 Views
Download Presentation
baba
Download Presentation

Biologia Molecular

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. TRANSCRIÇÃO E TRADUÇÃO DE PROTEÍNAS Biologia Molecular FABIANA SEIXAS email: fabianak@ufpel.edu.br

  2. ABORDAGENS... 1. Replicação do DNA 2. Célula Eucariótica X Célula Procariótica 3. Transcrição; 4. Tradução.

  3. Replicação DNA DNA Transcrição Trasncrição Reversa RNA Tradução Proteína REVISANDO

  4. Transcrição • É o processo pelo qual uma molécula de RNA é sintetizada a partir da informação contida na sequência de nucleotídeos de uma molécula de DNA de fita dupla

  5. “A Transcrição representa a diversidade e a complexidade da expressão dos genes contidos em um determinado genoma” “ É principalmente na transcrição que a célula exerce o controle da expressão gênica”

  6. DOGMA

  7. Célula Eucariótica

  8. Célula Procariótica

  9. PROCARIOTO X EUCARIOTO PROCARIOTO X EUCARIOTO

  10. RNA • Fita Simples; • A,U,C,G; • Ribose

  11. Estrutura do RNA • mRNA – 1 a 5 % do RNA total • rRNA – 75 % do RNA total • tRNA – 10 a 15 % do total • hnRNA – RNA heterogêneo nuclear • snRNA – RNA pequeno nuclear tRNA rRNA

  12. FASES DA TRANSCRIÇÃO • INÍCIO –quando ocorre reconhecimento de seqüência específica no DNA; • ALONGAMENTO– quando os ribonucleotídeos são sucessivamente incorporados; • TERMINAÇÃO –quando seqüências no DNA são reconhecidas e a síntese é interrompida.

  13. RNA POLIMERASE  Fator  (sigma)   ’   Core Haloenzima 

  14. RNA POLIMERASE

  15. RNA POLIMERASE Fator sigma

  16. FATOR SIGMA

  17. Promotor Terminador Região Codificadora DNA Ribossomo RNA PROTEÍNA Estrutura de um Gene

  18. ESTRUTURA DE UM GENE DE EUCARIOTO Promotor Região Codificadora Sítio de PoliA DNA Intron hnRNA AAAAAAAAAA RNA Exon mRNA AAAAAAAAAA

  19. CARACTERISTICAS DE UM PROMOTOR DE E. coli -35 -10 +1 TTGACA ...TATAATATCGATTTAGATCCCATGAT PROMOTOR • Região – 10: T A T A A T • Região – 35: T T G A C A • As duas regiões são separadas por 17±1 nucleotídeos • O primeiro nucleotídeo (+1) é geralmente uma purina (A ou G)

  20. PROMOTORES DE GENES BACTERIANOS

  21. -10 9 nucleotídeos

  22. TRANSCRIÇÃO

  23. FUNÇÕES DA RNA POLIMERASE • Reconhecer o promotor; • Desnaturar o DNA expondo a seqüência a ser copiada; • Manter as fitas de DNA separadas na região da síntese; • Manter o híbrido DNA:RNA estável; • Renaturar o DNA na região imediatamente posterior à síntese; • Terminar a síntese do RNA.

  24. TRANSCRIÇÃO

  25. TRANSCRIÇÃO

  26. TRANSCRIÇÃO

  27. TÉRMINO DA TRANSCRIÇÃO • Independente da proteína rho () (90% dos casos) • Dependente da proteína rho () 5’ CCCAGCCCGCCTAAGCGGGCTTTTTTTTGAC 3’ 3’ GGGTCGGGCGGATTCGCCCGAAAAAAACTG 5’ Pareamento A-U

  28. ENZIMAS DE RESTRIÇÃO TRANSCRIÇÃO - RNAm

  29. RNA MENSAGEIROANTISENSE Sintese Protéica RNA MENSAGEIRO antisense

  30. DNA fita codificadora DNA fita molde RNA transcrito Animação replicação/transcrição

  31. Código Genético e Sintese de Proteínas

  32. CÓDIGO GENÉTICO • É a relação entre a seqüência de bases no DNA e a seqüência de aminoácidos na proteína

  33. CÓDIGO GENÉTICO UUU PheUCUSer UAUTyrUGUCys UUC PheUCCSerUACTyr UGCCys UUA LeuUCA Ser UAA stopUGAstop UUGLeuUCGSerUAG stopUGGTrp CUU Leu CCU Pro CAU His CGUArg CUC Leu CCCProCAC HisCGCArg CUA LeuCCAProCAAGln CGAArg CUG Leu CCGProCAGGlnCGGArg AUUIleACUThrAAUAsn AGUSer AUC IleACC Thr AACAsn AGCSer AUA Ile ACAThr AAALysAGAArg AUG Met ACGThr AAGLys AGGArg GUUVal GCUAlaGAUAsp GGUGly GUCVal GCC Ala GACAsp GGCGly GUAVal GCAAla GAAGlu GGAGly GUGVal GCGAla GAGGlu GGGGly

  34. CÓDIGO GENÉTICO Características • Pareamento códon:anticódon; • Degeneração –um mesmo aminoácido pode ser codificado por vários códons diferentes; • Não ambigüidade–cada códon corresponde a somente um aminoácido; • Universalidade – o código genético é o mesmo nos mais diversos organismos (exceção: protozoários ciliados e mitocondiras); • Utilização preferencial de códons(codonusage).

  35. CÓDIGO GENÉTICO

  36. TRADUÇÃO • Consiste na transformação da mensagem contida no RNAm, via RNAt, na sequência de aminoácidos que constituem a proteína. • Intervenientes: • RNAm • RNAt • Ribossomas (RNAr) • Aminoácidos • Sistemas enzimáticos

  37. ESTRUTURA DOS RIBOSSOMOS • Procariotos • Subunidade 30S (rRNA 16S, 21 proteínas) • Subunidade 50S (rRNA 23S e 5S, 31 proteínas) • Total 70S • Eucariotos • Subunidade 40S (rRNA 18S) • Subunidade 60S (rRNA 28S, 5,8S e 5S) • Total 80S

  38. ESTRUTURA DOS RIBOSSOMOS Ribossomos

  39. tRNA -Estrutura secundária com grampos e alças formando um trevo -Alto número de bases modificadas depois da sua transcrição

  40. tRNA

  41. tRNA

  42. tRNA

  43. Existem 61 códons e 40 tRNAs. Como é resolvida a questão dos 21 códons restantes?

  44. Trasncrição Tradução

  45. Etapas da tradução • A síntese proteica ocorre em 3 etapas sucessivas: • 1. Iniciação • 2. Alongamento • 3. Finalização

  46. RIBOSSOMAS Sítio de ligação do ribossomo e códon de iniciação 5’ ...AGGAGGxxxxxxxAUG...3’ Códon de iniciação (raramente GUG ou UUG) RBS ou Seqüência Shine-Dalgarno