150 likes | 184 Views
Analysis of Xbp-mRNA. RT-PCR. Polymerase Chain Reaction (PCR). Reverse Transcription of Target RNA . Uses “downstream or “right primer” Extends from target right end (3’) to left end (5’) Uses DNA nucleotides Creates a “First Strand” of cDNA
E N D
Analysis of Xbp-mRNA RT-PCR
Reverse Transcription of Target RNA • Uses “downstream or “right primer” • Extends from target right end (3’) to left end (5’) • Uses DNA nucleotides • Creates a “First Strand” of cDNA • First strand is copied from left primer to give double stranded DNA
Designing Primers for RT-PCR for Xbp-1 mRNA Analysis • Criteria • Must bracket target sequence in mRNA • Must be at least 17 NT long • Must have a G+C content of ≈ 50-60% • Should have 5’ “GC clamp” • Should not dimerize • Should not form hairpin structures
WormBase Sumary for xbp-1 gene • Brief ID: xbp-1 encodes a bZIP transcription factor orthologous to yeast Hac1 and mammalian X box-binding protein 1 (XBP-1, OMIM:194355); XBP-1 is required for the unfolded protein response (UPR) that counteracts cellular stress induced by accumulation of unfolded proteins in the endoplasmic reticulum (ER); XBP-1 mRNA is spliced by the IRE-1 endoribonuclease to promote translation of transcriptionally active XBP-1 that positively regulates UPR gene expression to maintain ER homeostasis and promote normal development. [details] • Species: Caenorhabditis elegansCommon name: xbp-1 (CGC approved) • Gene model(s): Gene ModelStatusRemarkNucleotides (coding/transcript)ProteinSwissProtAmino AcidsR74.3confirmed by cDNA(s)C. elegans XBP-1 protein; contains similarity to Interpro domains IPR004827 (Basic-leucine zipper (bZIP) transcription factor), IPR008917 ()795/1747 bpWP:CE01056Q22027264 aa
Analysis of Primers Left Primer #1 5’ GCAAAGAGAACGAACGACTGAATCAT GC%= 39.13 TM = 58.2 Forms 1 low stability dimer Left Primer #2 5’ GAACCAGAGAACGAGTCCG GC% =60 TM =60.39 No dimers Right Primer 5’ TGTTCGAGGGTCTCCATCTTCTT 3’ (Reverse compliment of sense strand) GC% = 45.45 TM = 58.09 Forms one low stability dimer