Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
CÓDIGO GENÉTICO Y TRADUCCIÓN PowerPoint Presentation
Download Presentation
CÓDIGO GENÉTICO Y TRADUCCIÓN

CÓDIGO GENÉTICO Y TRADUCCIÓN

345 Views Download Presentation
Download Presentation

CÓDIGO GENÉTICO Y TRADUCCIÓN

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. CÓDIGO GENÉTICO Y TRADUCCIÓN Agosto de 2007

  2. Traducción “Verter una obra de una lengua a otra”. Convertir el lenguaje de los ARNm en el lenguaje de las proteínas. Agosto de 2007

  3. Traducción 4 letras 20 letras secuencia CÓDIGO nucleótidos aminoácidos TRADUCTOR Agosto de 2007

  4. PARE ADN PARE +1 AAAAA El mensaje promotor Transcripción Maduración del ARNm G ARNm Agosto de 2007

  5. PARE +1 G exones AAAAA El mensaje Transcripción Sitio de finalización de la traducción Sitio de inicio de la traducción Traducción Agosto de 2007

  6. El mensaje Eucariotas Promueven el reciclaje de los ribosomas Recluta los ribosomas G exones AAAAA Sitio de finalización de la traducción Sitio de inicio de la traducción Traducción Agosto de 2007

  7. PARE +1 inicio term. inicio term. Proteína Proteína El mensaje Procariotas Sec. de Shine-Dalgarno RBS RBS Agosto de 2007

  8. PARE +1 G AAAAA El mensaje ADN Marco abierto de lectura PROTEINA Agosto de 2007

  9. El mensaje ¿Qué es un marco abierto de lectura? La secuencia de ARNm capaz de especificar una proteína desde su inicio hasta su terminación. Agosto de 2007

  10. Código genético 4 letras 20 letras secuencia CÓDIGO nucleótidos aminoácidos TRADUCTOR Agosto de 2007

  11. Traducción ¿Qué molécula oficia de traductor? Agosto de 2007

  12. Traducción P. Zamecnick M.B. Hoagland P. Zamecnick 1957- Paul Zamecnick y M.B. Hoagland demuestran que los aminoaácidos se unen a un tipo de ARN, que llamaron ARN de transferencia. Agosto de 2007

  13. Paul Zamecnick En 1957 P. Zamecnick identifica la pieza que faltaba! Una fracción de ARN que no se comporta al centrifugar, igual que el ADN o el ARN. Permanecía en el sobrenadante con las enzimas y lo llamaban ARN chatarra ARN ATP algunos aminoácidos unidos Agosto de 2007

  14. Molécula de aminoácido El traductor Sitio de unión al aminoácido ARNt Sitio de unión al ARNm ARNm Agosto de 2007

  15. El traductor Sitio de reconocimiento Agosto de 2007

  16. El ARN de transferencia Brazo aceptor Asa U (pseudouridina) Asa D (Dihidrouridina) Asa variable Asa anticodón Agosto de 2007 Anticodón

  17. El ARN de transferencia Agosto de 2007

  18. El ARN de transferencia Asa  U Brazo aceptor Asa D Asa variable Asa anticodón Agosto de 2007

  19. El ARN de transferencia • ¿Cómo reconoce el ARNt el mensaje? • ¿Cómo reconoce el ARNt el aminoácido • que debe cargar? Agosto de 2007

  20. Traducción Aminoacil tRNA sintetasa tRNAGln Glutamil aminoacil tRNA sintetasa Agosto de 2007

  21. Aminoacil tRNA sintetasa ARNt ¿Otro código? Reconocimiento del aminoácido Agosto de 2007

  22. El código genético 4 letras secuencia 20 letras CÓDIGO nucleótidos aminoácidos Combinaciones de 4 letras 20 letras Agosto de 2007

  23. El código genético • Permutaciones de dos elementos 4 x 4 = 16 • Permutaciones de 3 elementos 4 x 4 x 4 = 64 Agosto de 2007

  24. El código genético Dos jóvenes y desconocidos investigadores, Marshal Nirenberg y Johann Matthaei hicieron la mezcla mágica: Polinucelótido sintético: UUUUUUUUU + Extracto libre de células Phe-Phe-Phe.... Agosto de 2007

  25. Código genético UCAG U A U U G U U C U U U U U C A G U U C U U A U U G U C C U C A U C G U A C U A A U A G U G C U G A U G G C U C CC AC G A C A AA G A U GU GCGAGG Agosto de 2007

  26. El código genético 2da posición 1a posición 5’ 3a posición Agosto de 2007

  27. Código genético 64 codones posibles 3 son codones de terminación 61 indican un aa Agosto de 2007

  28. Traducción AUGAAAGCAAUUUUCGUACUGAAAGGUUGA CÓDIGO DE TRES LETRAS Separo de tres en tres Aplico el código Agosto de 2007

  29. Traducción ..AUG AAA GCA AUU UUC GUA CUG AAA GGU UGA.. ..A UGA AAG CAA UUU UCG UAC UGA AAG GUG A AU GAA AGC AAU UUU CGU ACU GAA AGG UUA Agosto de 2007

  30. Traducción K Q F L Y K V E S N F R T E S L Código genético ..AUG AAA GCA AUU UUC GUA CUG AAA GGU UGA.. AUG UGA M K A I F V L K G ..A UGA AAG CAA UUU UCG UAC UGA AAG GUU A UGA UGA AU GAA AGC AAU UUU CGU ACU GAA AGG UUG A Agosto de 2007

  31. Traducción Código genético ..AUG AAA GCA AUU UUC GUA CUG AAA GGU UGA.. AUG UGA M K A I F V L K G ..A UGA AAG CAA UUU UCG UAC UGA AAG GUU A UGA UGA K Q F L Y K V AU GAA AGC AAU UUU CGU ACU GAA AGG UUG A E S N F R T E S L Agosto de 2007

  32. Código genético El código genético es DEGENERADO Agosto de 2007

  33. EXCEPCIONES Las famosas excepciones que confirman la regla CODIGO GENTICO CASI UNIVERSAL Agosto de 2007

  34. Traducción CÓDIGO nucleótidos aminoácidos TRADUCTOR Agosto de 2007

  35. centrífuga Ribosoma Subunidades S (Svedberg) = unidad de velocidad de sedimentación Agosto de 2007

  36. ARNr 5.8S 160 nucleótidos ARNr 5 S 120 nucleótidos ARNr 28S 4700 nucleótidos 49 proteínas ARNr 18S 33 proteínas Ribosoma Eucariota Agosto de 2007

  37. COOH NH2 C H H Factores proteicos Traducción Protagonistas Subunidades del ribosoma tRNAs Aa ARNm Agosto de 2007

  38. Sitio peptidil-tRNA Sitio de salida Aminoacil tRNA Ribosoma Sitios Agosto de 2007

  39. Traducción Etapas Reclutamiento del ARNm tRNA iniciador en sitio P Posicionamiento en el sitio de inicio Ensamblado del ribosoma • Iniciación • Elongación • Terminación Entrada de aa-tRNA al sitio a Formación del enlace peptídico Traslocación Salida del tRNA anterior Reconocimiento del codón de term. Hidrólisis de la cadena pp. del sitio P Agosto de 2007

  40. IF1 IF2 IF3 Factores de iniciación Traducción Iniciación Subunidades del ribosoma tRNA iniciador ARNm Agosto de 2007

  41. Iniciación Eucariotas apareamiento codón-anticodón Desplazamiento en busca del AUG liberación de factores 2 y 3 Unión de 60S Hidrólisis de GTP Y liberación de factores Complejo de iniciación Agosto de 2007

  42. Elongación • Unión del aminoacil tRNA correcto al sitio A • Formación del enlace peptídico • Traslocación al sitio P • Traslocación al sitio E • Salida del tRNA anterior Participación de factores de elongación GTP Agosto de 2007

  43. Elongación Unión del aminoacil-tRNA al sitio A Agosto de 2007

  44. Elongación Enlace peptídico Traslocación Agosto de 2007

  45. Terminación • No hay un tRNA terminador que reconozca el codón de terminación. • Hay proteínas que lo hacen!!! FACTORES DE LIBERCION Agosto de 2007

  46. Terminación • Reconocimiento del codón de terminación (RFs) • Hidrólisis de la proteína sintetizada • Liberación de los factores de terminación (RFs) • Reciclaje de los ribosomas Agosto de 2007

  47. Terminación RF-3-GDP Factor de liberación q’reconoce el stop Hidrólisis del péptido Agosto de 2007

  48. Terminación Reciclaje Los factores de liberación y un factor de reciclaje se combinan para eliminar los ARNt y el ARNm. Agosto de 2007

  49. Terminación Factor de reciclaje RRF Agosto de 2007

  50. Resumen La traducción es el proceso por el cual el mensaje contenido en el ARN es traducido al lenguaje de las proteínas y permite su síntesis. El código que permite este proceso es el código genético, casi universal y degenerado Hay 64 codones diferentes; 3 de ellos son de terminación y uno de iniciación. El papel de traductor lo oficia el ARN de transferencia. El ARNt reconoce el mensaje en el ARNm y transporta aminoácidos cargados por una enzima específica para cada uno de ellos, la aminoacil tRNA sintetasa. Agosto de 2007