file 5 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
File 5 PowerPoint Presentation
Download Presentation
File 5

Loading in 2 Seconds...

play fullscreen
1 / 10
aretha-rivera

File 5 - PowerPoint PPT Presentation

78 Views
Download Presentation
File 5
An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. File 5 MOUSE sequences used in target gene promoter regions to detect NFATc1 protein binding by ChIP

  2. UCSC Genome Browser on Mouse Dec 2011 (GRCm38/mm10) Assembly >chr2:33215795-33216118 ANGPTL2 (324 bpamplicon) F R Forward Primer ACGTCAGCCTTCAGGGAGTGGAGCAGGCTGGTGAGCCAGGAGCAGAGCTGGCCAGCCTTCCTGTGCCAAAGAAGGAGGGGGCCCCGCCCAGGCCGCCAAAGCAGGCAGGAGGGGCTGGGCCAGCTGGG GCTGGAGCTAGTGTGACATCACCAGGCGGCCCGCCCCTGTCTGGAGCTGAGGGGAGGCCCAGAGCTTTTCTGGGGCCTGGGGGATCCTCTTGCACTGGTGGGCGGAGAGAAGTGCCTGCAGCCAACCAGGGTCAGGCTGTGCTCACAGTTTCCTCTGGCGGCACGTAAAGGCTCCACAAAGGACCTGGGAGTTCAA Reverse Primer

  3. UCSC Genome Browser on Mouse Dec 2011 (GRCm38/mm10) Assembly >chr13:49543695-49544061 ASPN (367 bpamplicon) F R Forward Primer GGCTTGATTTGTGCCATTTCTTTGCGGTGGGAACCATAGATGATACTTTTTGACTGGAGAAACTAGATTTCTGCTAACTCACTAGATACCTTCTGTACCAACTGAGTATTTCCCCTTAGGGTCAATAAACCGCCCGTTCTTACAGGATTCTGTGCTTCAAGGATGTGGGGCTGGGTAATCTCTTGGAGTGGAAAGGGGGAAATGATTTTCTTCTTGAAGAATGGCATCTCTTGAACACTAGTGAGAAGGGAGCTGAGACTCTTGCAGAGGAAAGGTGGAGTTACCTGACTCTGCTTAGTTATCTGTACCACAACAGACGCAGGCCCAGGAAGAGTTTAAAGGGCCTGGCTTGCAGTTCCCAAAGAAG Reverse Primer

  4. UCSC Genome Browser on Mouse Dec 2011 (GRCm38/mm10) Assembly >chr1:45311266-45311543 Col3A1 (278 bpamplicon) R F Forward Primer CGGAGAATGGGAGTCAAAACACTTTTTCAAATTCAGACAGTTTTTACTGTTTCAGAGGGAAATTTAAAAACACACAAACAATTGTTGTAGGCTATCACAAAGCACATTCCTATGTGTTTCTGTCATGCAAATATGTATTTAAGACTAATGCATGTTATAAACATATGCATAGGCTGATGTACACATGCTCCAGATGTGCTGTTTCTGTGTCTGTGGGTTGTGTCCTCTACACACAGGGAAAAATATATTAATCATTGCTTTTACTGCTGAGGGGATGG Reverse Primer

  5. UCSC Genome Browser on Mouse Dec 2011 (GRCm38/mm10) Assembly FAP (286 bpamplicon) >chr2:62563670-62563955 F R Forward Primer AGCTGGAGCTCATGGAGGTATTTCCCCAACTGAAGCTCCCTTCTCTGTGATAACTCCAGCCTGTGTCAAGTTGACACACAAAACCAACCAGTACAAACTTGGACTTTAAACCCATCTGATTATAGAGGCTGAGTACATTACCATTATTGTTTAACATGAAAGCACACTTGTAGTAAAACAATAACAAATATAAAAACTAGAGCAAGAACCAAACAACACACAACACGTAGAAAAGTTATGCTTCAAAGCATAGATGATAAGAAAAGAAAGAAATCTGAGCTGCTTG Reverse Primer

  6. UCSC Genome Browser on Mouse Dec 2011 (GRCm38/mm10) Assembly >chr6:136875513-136875742 MGP (230 bpamplicon) F R Forward Primer TGATCATGGAAACAGGGAAGACTACTTCGTGGTACTTTGGCTTGTAATAGAGAACGGGAAAGATGAGGAAGAAGGGGAGAGAGACAGTGAGGAGCGTGAAGGGAAGTCCAAGGTAGGGAGGGAAAACCCACAGACAGCAGGGAGAGAGGTTTCTCACCGTAGCACAGGGTTGCCACGGCCAGCGCAGCCAGGATGGCCAGAGGGAGCAGGCTCTTCATGGTGTCTCGGGT Reverse Primer

  7. UCSC Genome Browser on Mouse Dec 2011 (GRCm38/mm10) Assembly >chr11:105292185-105292423 MRC2 (239 bpamplicon) F R Forward Primer ACTGGCCACCTGAGTCAGTCGCGCATCCCATCCTTCGGCTGGCCAGGCCTCGCAGCAGCCCAGGCTTCGCCACGCGGTGAAGTTCTGCGGAAAGTTTTGCAGTTGCTTCGCCTCTCGCGCCAGCAGGAGAAGCTGTGACGCAGCGTCTGGGGCTCCAGGCCCGGTCTGAAAAGAGAGGGTAGACAAGGCGGGAAGGAATTAAGAAGCAGAATAGGGGAAGATAAAGAGCGCACACTGGG Reverse Primer

  8. UCSC Genome Browser on Mouse Dec 2011 (GRCm38/mm10) Assembly >chr11:100970847-100971109 PTRF (263 bpamplicon) F R Forward Primer GACTGGGGCAGAGGAATGTGAGCTGCGGAAAGGAATTAGGTCTTCGGAGTGTGCTCTACTCTTTCTCTTTCCTCACCCACAAACCCACTCCAGCCTTTTAAGATCAAGCTGAGGTCCAAATGGCGCGTGAATTGGGTGTAAACGAGTAGTTTGTGTCTATGCCTCATGTCCTTGGAGGATCCTTGCCCTATACAATCTTTTTCAAAGATTTGGGGGTCTGCCCCCATCGTCTATCTATACACTGAGTTACCACTGTCCCCCAA Reverse Primer

  9. UCSC Genome Browser on Mouse Dec 2011 (GRCm38/mm10) Assembly >chr12:33957451-33957673 TWIST1 (223 bpamplicon) R F Forward Primer CAGGTCGGTTTTGAATGGTTCGCAGGACGAATTGTTAGACCCCGAGCAAGGGGGGAGGGGGCGAGGGAGGGGGGCTGGAAAGAGGAAACTTTCCTATAAAACTTCGAAAAGTCCCTCCTCCCCACGTCAGGCCAATGACACCGCTGCCCCCAAACTTTCCGCCCGCACGGAGGTATAAGAGCCGCCAAGTCCACAGCCCGCGCCCAACTCTCAGACACCTCGC Reverse Primer

  10. UCSC Genome Browser on Mouse Dec 2011 (GRCm38/mm10) Assembly >chr3:37126166-37126414 IL2 (249 bpamplicon) F R Forward Primer GTCGGGTTAGCCCACACTTAGGTGGCAGTTTTAATTCATACAATGAACGCCTTCTGTATGAAACAAATTTTCCTCTTTGGGGTGGAGACACAAAAGTAACTCATGAAAATGTTCTCTTTGTCAAAACCATCCTGAACCTGTAAGCAGCCTGTTGTGGTGGACAAACGCAAGAGGAGATAGATGAAAAGAATAAATCTTTTAGATTTGTTGATTAGACAGGAAGGATATTGGTTTCCTGTTTCAAGATGG Reverse Primer